ID: 1179749406

View in Genome Browser
Species Human (GRCh38)
Location 21:43459735-43459757
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 3, 1: 0, 2: 0, 3: 14, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179749406 Original CRISPR GGCCACAGGCTGACCCGTGC AGG Intergenic
900185811 1:1332764-1332786 CGCCTCAGGCTGCCCCGCGCAGG + Exonic
900205456 1:1430311-1430333 GGTCACAGGCTGAGCCCTGCTGG - Intergenic
900345546 1:2208683-2208705 GCCCACAGGCTTACCCGCTCTGG - Intronic
900429847 1:2596361-2596383 GGCCCCAGCCTGAGCCCTGCAGG - Intronic
900488548 1:2935078-2935100 GGCTGCAGGCTGACCCTTGGGGG - Intergenic
900537666 1:3186923-3186945 GGCCACTGGCTGACCGGGGCAGG - Intronic
900616768 1:3569033-3569055 GGCCTCTGGCAGACCCGTACCGG - Intronic
900726223 1:4218070-4218092 TGACCCAGGCTGACCAGTGCAGG - Intergenic
901460186 1:9386609-9386631 GGCCACGGGCTGACCCTCGGAGG + Intergenic
902620287 1:17646824-17646846 GGCCACTGGCTCCACCGTGCTGG - Intronic
904009060 1:27379739-27379761 GGCCACAGGCTTGCCTGGGCTGG + Exonic
904673221 1:32181251-32181273 GGCCCCAGACTGAGCCGTTCTGG - Exonic
905492757 1:38357335-38357357 GGCCTCATGCTGGCCTGTGCTGG - Intergenic
907524781 1:55047794-55047816 GGCCACAGGCTGCCCAGGCCGGG - Intronic
909538014 1:76760144-76760166 GGCCCCAGGCCAACCCATGCAGG + Intergenic
920013120 1:202884678-202884700 GCCCACAGGCAGACGCGTGACGG + Intronic
922596204 1:226815284-226815306 GGCCCCAGGGTGTCCTGTGCTGG - Intergenic
922642113 1:227244926-227244948 GGCCACTGGCTGAGCCCAGCAGG - Intronic
1064562183 10:16604498-16604520 GGCCAGAAGCTGGACCGTGCAGG - Intronic
1069625917 10:69867559-69867581 GGCCCCAGGCTCAGCCCTGCTGG - Intronic
1069897797 10:71689645-71689667 GGCCACAGGCTGAGCCCCACAGG - Intronic
1070360262 10:75681550-75681572 GGGCACAGGCTGACCCTTCAGGG + Intronic
1070808776 10:79286836-79286858 GGCCACAGGCAGGGCCCTGCCGG + Intronic
1073186920 10:101620557-101620579 GCCCACAGGCTGGCCAGAGCGGG + Intronic
1074101584 10:110358330-110358352 GGACAGAGGCTGACCCATGAGGG - Intergenic
1074819586 10:117168296-117168318 GCCCACAGGCAGAGCCGGGCGGG - Intergenic
1075726729 10:124614400-124614422 GGCCACAGGCTGTTCCGTTAGGG - Intronic
1076629247 10:131842535-131842557 GGTCACAGGCTGACCTTTTCTGG - Intergenic
1077158965 11:1104015-1104037 GGCCACAGGCAGGCCTGGGCGGG - Intergenic
1078418374 11:11184815-11184837 GGACACAGGCTGATCTGTACAGG - Intergenic
1079107054 11:17578473-17578495 GGCCACGGGCTGACACGCTCAGG - Exonic
1079452807 11:20611869-20611891 GGGCCCAGGCTGTCCCTTGCAGG + Intronic
1080640762 11:34157139-34157161 GGCTTCAGGCTGACCCCTCCAGG + Intronic
1084523701 11:69682923-69682945 GGGCAGAGGCTGAGCCCTGCTGG - Intergenic
1087113242 11:94494125-94494147 GGACACAGGCCGAGCCCTGCAGG + Intronic
1089771514 11:120806518-120806540 GGCCACAGGGTGACAGGTGTAGG - Intronic
1090202703 11:124867652-124867674 CTGGACAGGCTGACCCGTGCTGG - Intronic
1091263785 11:134254069-134254091 GGCCGCAGGAGGACCCGGGCCGG - Intronic
1091564085 12:1635106-1635128 GCCCAAAGGCTGCCCCGTGAAGG + Intronic
1091662394 12:2394183-2394205 GGCCTCCGCCTGGCCCGTGCTGG - Intronic
1091826826 12:3519154-3519176 GGCCACGAGCTGAGCCGTGCTGG - Intronic
1092094897 12:5833558-5833580 GGCCACAAACTGACCGGTACTGG + Intronic
1092137957 12:6162744-6162766 GGCCACAGGCTGATGAATGCTGG + Intergenic
1096072824 12:48784997-48785019 GGTCCCAGGCTGGCCTGTGCGGG - Intronic
1096775871 12:53963753-53963775 GGGCAGTGGCTGACCCGAGCCGG + Intergenic
1098454955 12:70661655-70661677 TGCCACACCCTCACCCGTGCTGG - Intronic
1102645509 12:114401034-114401056 GGCCACATCCCTACCCGTGCTGG - Intronic
1103600527 12:122051625-122051647 AGACTCACGCTGACCCGTGCTGG - Intronic
1104230748 12:126881535-126881557 GGGCACTGGCTGATCTGTGCTGG - Intergenic
1106045323 13:26134358-26134380 GGCCTCACGCTCACCCATGCCGG - Intronic
1108647823 13:52448378-52448400 GGGCACAGGCTGACTCCTGGGGG - Intronic
1110297397 13:73884498-73884520 GGCCAGAGGCAGACCAGAGCAGG - Intronic
1110670306 13:78169488-78169510 GGCCACCTGCAGACCAGTGCTGG + Intergenic
1116707336 14:48318961-48318983 GGCCACAGGGAGACCCAGGCTGG + Intergenic
1118760466 14:68877910-68877932 GCCCACAGGCTGTCCAGCGCAGG - Intronic
1119403179 14:74378249-74378271 GTCCAGAAGCAGACCCGTGCCGG - Intergenic
1121820504 14:96962048-96962070 TGCCATAGGATGACCCTTGCTGG + Intergenic
1122297675 14:100714423-100714445 CGGCACAGGCTGAGCAGTGCTGG - Intergenic
1122375030 14:101251726-101251748 AGCCACATGCAGACCCGGGCCGG - Intergenic
1122740706 14:103870174-103870196 GGCCACAGGCTGGTACGTGGGGG + Intergenic
1122853094 14:104547262-104547284 GGCCTCATGCTGGCCCATGCGGG + Intronic
1122977648 14:105177511-105177533 GGCCTCAGGCTGACCCCTCAGGG + Intronic
1126174938 15:45727526-45727548 GGCCACAGGTTTACCTGTGATGG - Intergenic
1128421183 15:67492767-67492789 GGCCACAGGAAGAGCAGTGCAGG + Intronic
1131228673 15:90645407-90645429 AGCTGCAGGCTGAGCCGTGCAGG - Intergenic
1132485347 16:187432-187454 TGCCACAGGCTGTCCCCTCCAGG - Intergenic
1132933919 16:2471671-2471693 GGCCACTGGCTGACCCGCAGCGG + Exonic
1136239998 16:28937779-28937801 GGTCCCAGGCTGACCCATGAGGG - Exonic
1139974024 16:70794736-70794758 GGTCACAGGCTGGCCCCTGGGGG - Intronic
1141828234 16:86495639-86495661 GCCCCCAGGCTGACCCTTGATGG + Intergenic
1141835941 16:86539271-86539293 GGCCATAGGGAGACACGTGCAGG + Intronic
1142034843 16:87856527-87856549 GGCCACAGGCTGCACTGGGCGGG - Intronic
1142560298 17:805449-805471 GGTTACAGGCTGACCCGAGGGGG - Intronic
1144359479 17:14478268-14478290 GGCCACACTCTGGCCCTTGCTGG + Intergenic
1145288200 17:21522201-21522223 GGCCACAGGCCGAGCCATCCAGG - Intergenic
1145389440 17:22444242-22444264 GGCCACAGGCTGTGCCATCCAGG + Intergenic
1145754467 17:27380701-27380723 TGCTACAGGCTGCTCCGTGCAGG - Intergenic
1147659273 17:42108577-42108599 GGCGACCGGCTGTCCCTTGCAGG - Intronic
1148572148 17:48678600-48678622 GGCCAAACACTGACCCCTGCCGG - Intergenic
1151632467 17:75320239-75320261 GGTCACAGGGTGACCCGGCCAGG + Exonic
1153091484 18:1350492-1350514 GGCCAGAGGCTTACCAGTGATGG - Intergenic
1156454685 18:37286391-37286413 AGCCACAGGCTGACCCTTATGGG + Intronic
1157394089 18:47327388-47327410 GTCCACATGCTGCCCTGTGCTGG - Intergenic
1160392328 18:78543578-78543600 GGCCACATGCTCACCAGTGCTGG + Intergenic
1160843084 19:1155099-1155121 GGACCCAGGCTGGCCCGTGGTGG + Intronic
1163592587 19:18202896-18202918 GGTCACAGGCTGCCCTCTGCTGG - Intronic
1166083541 19:40459982-40460004 GCCTACAGACTGACCAGTGCTGG + Intronic
1166703035 19:44893129-44893151 GGCCCCATGCTGAGCAGTGCTGG + Intronic
1167643733 19:50695157-50695179 CGCCTCATGCTGACCCGCGCCGG + Intronic
1168348280 19:55661270-55661292 GAGCAGAGTCTGACCCGTGCAGG - Intronic
1168713236 19:58513413-58513435 GCCCACAGGCTGTCCTGGGCAGG - Intergenic
926019591 2:9483535-9483557 GGCCACAGGAGGACCTATGCTGG - Intronic
926329717 2:11814312-11814334 GGCATCAGGGTGACCTGTGCAGG + Intronic
927481636 2:23458453-23458475 GGCCACAGGCTATCGCGTGCTGG + Intronic
927922208 2:26981726-26981748 AGCCACTGGCTGACACGTGGAGG - Intronic
931937538 2:67215100-67215122 GGGCACAGGCTGAGCCTTGCGGG - Intergenic
933975651 2:87507144-87507166 GGCCAGAGGCTGGCCACTGCTGG - Intergenic
934570951 2:95373018-95373040 GGGCACAGGATGAGCTGTGCAGG + Intronic
936318173 2:111443669-111443691 GGCCAGAGGCTGGCCACTGCTGG + Intergenic
936428180 2:112436703-112436725 GGCCACAGGCTGACCCGTGCAGG + Intergenic
947585831 2:231356089-231356111 GCCCACAGCCAGACCCATGCTGG + Intronic
1168769832 20:408092-408114 GCCCGCAGGGTGACCCGGGCGGG + Exonic
1171398981 20:24859389-24859411 GGGCACAGGCGGACCCTTGCGGG + Intergenic
1172974947 20:38899306-38899328 GGCCACAGCCTGATCAGTGATGG + Intronic
1174107010 20:48169635-48169657 GGCCACCAGCTCACCAGTGCTGG - Intergenic
1175253675 20:57625226-57625248 GGCCACATGCTGGGCCCTGCAGG + Intergenic
1175658466 20:60792235-60792257 AGCCACAGGCTGACAAATGCAGG - Intergenic
1176030066 20:63007456-63007478 GGCCACAGGGCGCCCCGAGCAGG - Intergenic
1176374071 21:6078508-6078530 GGCCACAGGCTGACCCGTGCAGG - Intergenic
1179749406 21:43459735-43459757 GGCCACAGGCTGACCCGTGCAGG + Intergenic
1180187677 21:46147593-46147615 GGGCACAGCCAGACCTGTGCAGG + Intronic
1180694714 22:17744320-17744342 GGCCACAGGCTGTTCCGGGGAGG + Intronic
1184286730 22:43476238-43476260 GGCCACAGGGTGCCCAGTGCTGG + Intronic
1184335967 22:43853446-43853468 GTCCACAGCCAGACCCCTGCTGG + Intronic
1185372557 22:50467772-50467794 GGCCCCAAGCTGACCTGTGAAGG + Exonic
952195876 3:31074998-31075020 GGCCACAGGCTGCCTGGTGGAGG + Intergenic
953981911 3:47417567-47417589 GGCCACAGACCGCCCGGTGCCGG + Exonic
954307662 3:49738261-49738283 TGCCACTGCCTGACCGGTGCAGG + Exonic
961415521 3:126753816-126753838 GGGCACATGCTGAGCCTTGCTGG + Intronic
961567407 3:127773541-127773563 GGACACAGGCTGTGCCGGGCTGG + Intronic
962233951 3:133692322-133692344 GGCCTCAGTCTGACTCTTGCAGG + Intergenic
968132941 3:196202628-196202650 GGCCAGAGGCTGAGCCCTGAGGG + Intronic
968900211 4:3427393-3427415 GGCCACAGGCTGGCCTCTGCTGG - Intronic
970900451 4:21152662-21152684 GGCCACAGACTGACAGGTCCTGG + Intronic
978618096 4:110615372-110615394 GGCTAGAGGGGGACCCGTGCAGG + Intergenic
984219159 4:176952321-176952343 GGCCACAGGCTGGCGTGGGCAGG - Intergenic
989188472 5:38646924-38646946 GGCCCCAGGCTGCCCCAGGCAGG + Intergenic
990236330 5:53771747-53771769 GGCCTCAGGCTGGCCCCTGTAGG + Intergenic
998805760 5:145916471-145916493 GGCCCCAGGCTGAACCCTGAGGG + Intergenic
999782003 5:154857584-154857606 GGCCACACGCTGCCCAGGGCCGG + Intronic
1004560786 6:16748221-16748243 TGACACAGGCTGTCCCATGCAGG - Intronic
1006393336 6:33771673-33771695 GGCTGCAGGCTGCCCCCTGCCGG - Exonic
1006631370 6:35432456-35432478 GGACACAGGCTGCCCTGAGCAGG - Intergenic
1007112758 6:39322527-39322549 GGCCACAGCATGCCCAGTGCTGG - Exonic
1007733710 6:43967474-43967496 GGCCACAGGCAGAACCCTGTGGG + Intergenic
1012861876 6:104570106-104570128 AGCCATAGGATGACCCTTGCCGG - Intergenic
1013752753 6:113426175-113426197 GGCCACAGACTGACCCTTCCTGG - Intergenic
1015485394 6:133764295-133764317 TGCCACAGGCTGGCCTGAGCTGG - Intergenic
1019407618 7:891956-891978 GGCCAGCGCCTGACCGGTGCGGG + Intronic
1019528621 7:1492894-1492916 GGGCGCAGGCTTACCCGGGCGGG + Intronic
1019726520 7:2605914-2605936 GGCCACGGGCAGCCCTGTGCAGG + Exonic
1019753870 7:2753425-2753447 GGCCACATGCTGCCAGGTGCAGG - Intronic
1019911105 7:4100954-4100976 TGCCCCAGGCTGAACCCTGCAGG + Intronic
1023761019 7:43465382-43465404 GGCCACAGGCTGACCTGAGATGG + Intronic
1023984918 7:45088814-45088836 GGCCACGGCCTCACCTGTGCGGG + Exonic
1025015896 7:55438978-55439000 CGCCACAGGCTGAGGCATGCAGG + Intronic
1034291361 7:149934697-149934719 GGCCACAGGCTGGTCAGTGCGGG + Intergenic
1034814737 7:154162197-154162219 GGCCACAGGCTGGTCAGTGCGGG - Intronic
1036504054 8:9339302-9339324 GGCCAGAGGCTGAACCATTCGGG - Intergenic
1038554222 8:28494873-28494895 GGCCCGAAGCTGACCCGAGCCGG - Intronic
1040283772 8:46089186-46089208 GGCCACAGGCAGGCCTGTGAAGG + Intergenic
1040284872 8:46094550-46094572 GGCCACAGGTGGGCCTGTGCAGG + Intergenic
1040285278 8:46097581-46097603 GGCCACAGACTGGGCTGTGCAGG + Intergenic
1040289781 8:46118346-46118368 GGCCACAGGGTGGCGTGTGCAGG - Intergenic
1040296620 8:46152264-46152286 GGCCACAGGTTAGCCTGTGCAGG - Intergenic
1040314821 8:46255336-46255358 GGCCACAGGCAGGCACGGGCGGG + Intergenic
1040325809 8:46340940-46340962 GGCCACAGGGTGACCTGGGAGGG + Intergenic
1040332865 8:46401213-46401235 GGCCACAGGCAGGCCTGTTCGGG - Intergenic
1040332965 8:46401638-46401660 GGCCACAGGCAGGCCTGTGCGGG - Intergenic
1040338817 8:46429675-46429697 GCCCCCAGGCTGTCCCGGGCAGG + Intergenic
1049665979 8:143842813-143842835 GGACACCTGCAGACCCGTGCTGG + Intergenic
1049676193 8:143890355-143890377 GGTCACAGCCTGGCCCTTGCTGG - Intergenic
1050183189 9:2942516-2942538 AGCCACAGGCTTTCCCGTGGGGG - Intergenic
1052989231 9:34509085-34509107 AGCCACAGACTGACCAGGGCAGG + Intronic
1053352833 9:37424732-37424754 GGCCTCAGGCTGCCCGGGGCTGG - Intronic
1054454732 9:65424004-65424026 GGCTACAGGCAGAGCCATGCTGG - Intergenic
1062040816 9:134403518-134403540 GGCCCCAGGATGCCCCTTGCTGG + Intronic
1062142376 9:134966772-134966794 GGTCACAGACTGGACCGTGCTGG - Intergenic
1062443360 9:136583386-136583408 GGCCATGGGCTGGCCCGGGCTGG + Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062685279 9:137809483-137809505 GGCCCAAGGCAGACCCCTGCAGG - Intronic
1189367322 X:40398767-40398789 AGCCACATGCTGACCAGAGCTGG - Intergenic
1189839848 X:45063576-45063598 GGCCAAAGGCTGCCCAGGGCAGG - Exonic
1189847257 X:45149104-45149126 GACCACATGCTGACCCACGCAGG + Exonic
1198266925 X:135018160-135018182 GCTCACAGGCTGACCAGTCCTGG + Intergenic