ID: 1179749739

View in Genome Browser
Species Human (GRCh38)
Location 21:43460999-43461021
Sequence GCTTCCTCCAGGAGGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179749739_1179749747 -7 Left 1179749739 21:43460999-43461021 CCACCCAGCCTCCTGGAGGAAGC No data
Right 1179749747 21:43461015-43461037 AGGAAGCGGCCGGGCAGCGCTGG No data
1179749739_1179749749 15 Left 1179749739 21:43460999-43461021 CCACCCAGCCTCCTGGAGGAAGC No data
Right 1179749749 21:43461037-43461059 GCACCGTTCCACATCCCTGCTGG No data
1179749739_1179749753 24 Left 1179749739 21:43460999-43461021 CCACCCAGCCTCCTGGAGGAAGC No data
Right 1179749753 21:43461046-43461068 CACATCCCTGCTGGAGCAATGGG No data
1179749739_1179749752 23 Left 1179749739 21:43460999-43461021 CCACCCAGCCTCCTGGAGGAAGC No data
Right 1179749752 21:43461045-43461067 CCACATCCCTGCTGGAGCAATGG No data
1179749739_1179749754 25 Left 1179749739 21:43460999-43461021 CCACCCAGCCTCCTGGAGGAAGC No data
Right 1179749754 21:43461047-43461069 ACATCCCTGCTGGAGCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179749739 Original CRISPR GCTTCCTCCAGGAGGCTGGG TGG (reversed) Intergenic
No off target data available for this crispr