ID: 1179749742

View in Genome Browser
Species Human (GRCh38)
Location 21:43461003-43461025
Sequence GGCCGCTTCCTCCAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179749742_1179749754 21 Left 1179749742 21:43461003-43461025 CCAGCCTCCTGGAGGAAGCGGCC No data
Right 1179749754 21:43461047-43461069 ACATCCCTGCTGGAGCAATGGGG No data
1179749742_1179749752 19 Left 1179749742 21:43461003-43461025 CCAGCCTCCTGGAGGAAGCGGCC No data
Right 1179749752 21:43461045-43461067 CCACATCCCTGCTGGAGCAATGG No data
1179749742_1179749757 30 Left 1179749742 21:43461003-43461025 CCAGCCTCCTGGAGGAAGCGGCC No data
Right 1179749757 21:43461056-43461078 CTGGAGCAATGGGGCCAGCGTGG No data
1179749742_1179749749 11 Left 1179749742 21:43461003-43461025 CCAGCCTCCTGGAGGAAGCGGCC No data
Right 1179749749 21:43461037-43461059 GCACCGTTCCACATCCCTGCTGG No data
1179749742_1179749753 20 Left 1179749742 21:43461003-43461025 CCAGCCTCCTGGAGGAAGCGGCC No data
Right 1179749753 21:43461046-43461068 CACATCCCTGCTGGAGCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179749742 Original CRISPR GGCCGCTTCCTCCAGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr