ID: 1179749747

View in Genome Browser
Species Human (GRCh38)
Location 21:43461015-43461037
Sequence AGGAAGCGGCCGGGCAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179749739_1179749747 -7 Left 1179749739 21:43460999-43461021 CCACCCAGCCTCCTGGAGGAAGC No data
Right 1179749747 21:43461015-43461037 AGGAAGCGGCCGGGCAGCGCTGG No data
1179749741_1179749747 -10 Left 1179749741 21:43461002-43461024 CCCAGCCTCCTGGAGGAAGCGGC No data
Right 1179749747 21:43461015-43461037 AGGAAGCGGCCGGGCAGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179749747 Original CRISPR AGGAAGCGGCCGGGCAGCGC TGG Intergenic
No off target data available for this crispr