ID: 1179749748

View in Genome Browser
Species Human (GRCh38)
Location 21:43461024-43461046
Sequence GGAACGGTGCCAGCGCTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179749748_1179749749 -10 Left 1179749748 21:43461024-43461046 CCGGGCAGCGCTGGCACCGTTCC No data
Right 1179749749 21:43461037-43461059 GCACCGTTCCACATCCCTGCTGG No data
1179749748_1179749757 9 Left 1179749748 21:43461024-43461046 CCGGGCAGCGCTGGCACCGTTCC No data
Right 1179749757 21:43461056-43461078 CTGGAGCAATGGGGCCAGCGTGG No data
1179749748_1179749754 0 Left 1179749748 21:43461024-43461046 CCGGGCAGCGCTGGCACCGTTCC No data
Right 1179749754 21:43461047-43461069 ACATCCCTGCTGGAGCAATGGGG No data
1179749748_1179749753 -1 Left 1179749748 21:43461024-43461046 CCGGGCAGCGCTGGCACCGTTCC No data
Right 1179749753 21:43461046-43461068 CACATCCCTGCTGGAGCAATGGG No data
1179749748_1179749759 29 Left 1179749748 21:43461024-43461046 CCGGGCAGCGCTGGCACCGTTCC No data
Right 1179749759 21:43461076-43461098 TGGCCGCCCCACCCAGTCAGTGG No data
1179749748_1179749752 -2 Left 1179749748 21:43461024-43461046 CCGGGCAGCGCTGGCACCGTTCC No data
Right 1179749752 21:43461045-43461067 CCACATCCCTGCTGGAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179749748 Original CRISPR GGAACGGTGCCAGCGCTGCC CGG (reversed) Intergenic
No off target data available for this crispr