ID: 1179749752

View in Genome Browser
Species Human (GRCh38)
Location 21:43461045-43461067
Sequence CCACATCCCTGCTGGAGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179749746_1179749752 12 Left 1179749746 21:43461010-43461032 CCTGGAGGAAGCGGCCGGGCAGC No data
Right 1179749752 21:43461045-43461067 CCACATCCCTGCTGGAGCAATGG No data
1179749739_1179749752 23 Left 1179749739 21:43460999-43461021 CCACCCAGCCTCCTGGAGGAAGC No data
Right 1179749752 21:43461045-43461067 CCACATCCCTGCTGGAGCAATGG No data
1179749745_1179749752 15 Left 1179749745 21:43461007-43461029 CCTCCTGGAGGAAGCGGCCGGGC No data
Right 1179749752 21:43461045-43461067 CCACATCCCTGCTGGAGCAATGG No data
1179749748_1179749752 -2 Left 1179749748 21:43461024-43461046 CCGGGCAGCGCTGGCACCGTTCC No data
Right 1179749752 21:43461045-43461067 CCACATCCCTGCTGGAGCAATGG No data
1179749742_1179749752 19 Left 1179749742 21:43461003-43461025 CCAGCCTCCTGGAGGAAGCGGCC No data
Right 1179749752 21:43461045-43461067 CCACATCCCTGCTGGAGCAATGG No data
1179749741_1179749752 20 Left 1179749741 21:43461002-43461024 CCCAGCCTCCTGGAGGAAGCGGC No data
Right 1179749752 21:43461045-43461067 CCACATCCCTGCTGGAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179749752 Original CRISPR CCACATCCCTGCTGGAGCAA TGG Intergenic
No off target data available for this crispr