ID: 1179749757

View in Genome Browser
Species Human (GRCh38)
Location 21:43461056-43461078
Sequence CTGGAGCAATGGGGCCAGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179749750_1179749757 -7 Left 1179749750 21:43461040-43461062 CCGTTCCACATCCCTGCTGGAGC No data
Right 1179749757 21:43461056-43461078 CTGGAGCAATGGGGCCAGCGTGG No data
1179749748_1179749757 9 Left 1179749748 21:43461024-43461046 CCGGGCAGCGCTGGCACCGTTCC No data
Right 1179749757 21:43461056-43461078 CTGGAGCAATGGGGCCAGCGTGG No data
1179749745_1179749757 26 Left 1179749745 21:43461007-43461029 CCTCCTGGAGGAAGCGGCCGGGC No data
Right 1179749757 21:43461056-43461078 CTGGAGCAATGGGGCCAGCGTGG No data
1179749742_1179749757 30 Left 1179749742 21:43461003-43461025 CCAGCCTCCTGGAGGAAGCGGCC No data
Right 1179749757 21:43461056-43461078 CTGGAGCAATGGGGCCAGCGTGG No data
1179749746_1179749757 23 Left 1179749746 21:43461010-43461032 CCTGGAGGAAGCGGCCGGGCAGC No data
Right 1179749757 21:43461056-43461078 CTGGAGCAATGGGGCCAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179749757 Original CRISPR CTGGAGCAATGGGGCCAGCG TGG Intergenic
No off target data available for this crispr