ID: 1179749759

View in Genome Browser
Species Human (GRCh38)
Location 21:43461076-43461098
Sequence TGGCCGCCCCACCCAGTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179749751_1179749759 8 Left 1179749751 21:43461045-43461067 CCACATCCCTGCTGGAGCAATGG No data
Right 1179749759 21:43461076-43461098 TGGCCGCCCCACCCAGTCAGTGG No data
1179749756_1179749759 1 Left 1179749756 21:43461052-43461074 CCTGCTGGAGCAATGGGGCCAGC No data
Right 1179749759 21:43461076-43461098 TGGCCGCCCCACCCAGTCAGTGG No data
1179749748_1179749759 29 Left 1179749748 21:43461024-43461046 CCGGGCAGCGCTGGCACCGTTCC No data
Right 1179749759 21:43461076-43461098 TGGCCGCCCCACCCAGTCAGTGG No data
1179749750_1179749759 13 Left 1179749750 21:43461040-43461062 CCGTTCCACATCCCTGCTGGAGC No data
Right 1179749759 21:43461076-43461098 TGGCCGCCCCACCCAGTCAGTGG No data
1179749755_1179749759 2 Left 1179749755 21:43461051-43461073 CCCTGCTGGAGCAATGGGGCCAG No data
Right 1179749759 21:43461076-43461098 TGGCCGCCCCACCCAGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179749759 Original CRISPR TGGCCGCCCCACCCAGTCAG TGG Intergenic
No off target data available for this crispr