ID: 1179750012

View in Genome Browser
Species Human (GRCh38)
Location 21:43462160-43462182
Sequence TCTGGGGCAATCGCCGCTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179750007_1179750012 -2 Left 1179750007 21:43462139-43462161 CCTTAGCAGCGCCAAGTTCTTTC No data
Right 1179750012 21:43462160-43462182 TCTGGGGCAATCGCCGCTGTTGG No data
1179750005_1179750012 7 Left 1179750005 21:43462130-43462152 CCGCCATTGCCTTAGCAGCGCCA No data
Right 1179750012 21:43462160-43462182 TCTGGGGCAATCGCCGCTGTTGG No data
1179750006_1179750012 4 Left 1179750006 21:43462133-43462155 CCATTGCCTTAGCAGCGCCAAGT No data
Right 1179750012 21:43462160-43462182 TCTGGGGCAATCGCCGCTGTTGG No data
1179750004_1179750012 18 Left 1179750004 21:43462119-43462141 CCTCTTTCGGGCCGCCATTGCCT No data
Right 1179750012 21:43462160-43462182 TCTGGGGCAATCGCCGCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179750012 Original CRISPR TCTGGGGCAATCGCCGCTGT TGG Intergenic
No off target data available for this crispr