ID: 1179750609

View in Genome Browser
Species Human (GRCh38)
Location 21:43465104-43465126
Sequence GTGTGTTGGGGGGGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179750596_1179750609 14 Left 1179750596 21:43465067-43465089 CCAGGTTTCTTCAACAGATAAAC No data
Right 1179750609 21:43465104-43465126 GTGTGTTGGGGGGGGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179750609 Original CRISPR GTGTGTTGGGGGGGGGTGGG GGG Intergenic
No off target data available for this crispr