ID: 1179750838

View in Genome Browser
Species Human (GRCh38)
Location 21:43466602-43466624
Sequence CATTTCAGGCACGGCCAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179750838_1179750849 22 Left 1179750838 21:43466602-43466624 CCTACTTGGCCGTGCCTGAAATG No data
Right 1179750849 21:43466647-43466669 TATGGTTGCAGAGGCCACAAGGG No data
1179750838_1179750851 26 Left 1179750838 21:43466602-43466624 CCTACTTGGCCGTGCCTGAAATG No data
Right 1179750851 21:43466651-43466673 GTTGCAGAGGCCACAAGGGAGGG No data
1179750838_1179750850 25 Left 1179750838 21:43466602-43466624 CCTACTTGGCCGTGCCTGAAATG No data
Right 1179750850 21:43466650-43466672 GGTTGCAGAGGCCACAAGGGAGG No data
1179750838_1179750846 13 Left 1179750838 21:43466602-43466624 CCTACTTGGCCGTGCCTGAAATG No data
Right 1179750846 21:43466638-43466660 CCGCATTCCTATGGTTGCAGAGG No data
1179750838_1179750848 21 Left 1179750838 21:43466602-43466624 CCTACTTGGCCGTGCCTGAAATG No data
Right 1179750848 21:43466646-43466668 CTATGGTTGCAGAGGCCACAAGG No data
1179750838_1179750842 4 Left 1179750838 21:43466602-43466624 CCTACTTGGCCGTGCCTGAAATG No data
Right 1179750842 21:43466629-43466651 TTCCAAAACCCGCATTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179750838 Original CRISPR CATTTCAGGCACGGCCAAGT AGG (reversed) Intergenic
No off target data available for this crispr