ID: 1179750840

View in Genome Browser
Species Human (GRCh38)
Location 21:43466616-43466638
Sequence GGTTTTGGAAGTGGCATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179750840_1179750850 11 Left 1179750840 21:43466616-43466638 CCTGAAATGCCACTTCCAAAACC No data
Right 1179750850 21:43466650-43466672 GGTTGCAGAGGCCACAAGGGAGG No data
1179750840_1179750849 8 Left 1179750840 21:43466616-43466638 CCTGAAATGCCACTTCCAAAACC No data
Right 1179750849 21:43466647-43466669 TATGGTTGCAGAGGCCACAAGGG No data
1179750840_1179750848 7 Left 1179750840 21:43466616-43466638 CCTGAAATGCCACTTCCAAAACC No data
Right 1179750848 21:43466646-43466668 CTATGGTTGCAGAGGCCACAAGG No data
1179750840_1179750842 -10 Left 1179750840 21:43466616-43466638 CCTGAAATGCCACTTCCAAAACC No data
Right 1179750842 21:43466629-43466651 TTCCAAAACCCGCATTCCTATGG No data
1179750840_1179750852 21 Left 1179750840 21:43466616-43466638 CCTGAAATGCCACTTCCAAAACC No data
Right 1179750852 21:43466660-43466682 GCCACAAGGGAGGGCCCTCGTGG No data
1179750840_1179750851 12 Left 1179750840 21:43466616-43466638 CCTGAAATGCCACTTCCAAAACC No data
Right 1179750851 21:43466651-43466673 GTTGCAGAGGCCACAAGGGAGGG No data
1179750840_1179750846 -1 Left 1179750840 21:43466616-43466638 CCTGAAATGCCACTTCCAAAACC No data
Right 1179750846 21:43466638-43466660 CCGCATTCCTATGGTTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179750840 Original CRISPR GGTTTTGGAAGTGGCATTTC AGG (reversed) Intergenic
No off target data available for this crispr