ID: 1179750842

View in Genome Browser
Species Human (GRCh38)
Location 21:43466629-43466651
Sequence TTCCAAAACCCGCATTCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179750839_1179750842 -5 Left 1179750839 21:43466611-43466633 CCGTGCCTGAAATGCCACTTCCA No data
Right 1179750842 21:43466629-43466651 TTCCAAAACCCGCATTCCTATGG No data
1179750838_1179750842 4 Left 1179750838 21:43466602-43466624 CCTACTTGGCCGTGCCTGAAATG No data
Right 1179750842 21:43466629-43466651 TTCCAAAACCCGCATTCCTATGG No data
1179750840_1179750842 -10 Left 1179750840 21:43466616-43466638 CCTGAAATGCCACTTCCAAAACC No data
Right 1179750842 21:43466629-43466651 TTCCAAAACCCGCATTCCTATGG No data
1179750836_1179750842 24 Left 1179750836 21:43466582-43466604 CCTAGGGTCTCTTCTAATTTCCT No data
Right 1179750842 21:43466629-43466651 TTCCAAAACCCGCATTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179750842 Original CRISPR TTCCAAAACCCGCATTCCTA TGG Intergenic
No off target data available for this crispr