ID: 1179750843

View in Genome Browser
Species Human (GRCh38)
Location 21:43466631-43466653
Sequence AACCATAGGAATGCGGGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179750843_1179750852 6 Left 1179750843 21:43466631-43466653 CCAAAACCCGCATTCCTATGGTT No data
Right 1179750852 21:43466660-43466682 GCCACAAGGGAGGGCCCTCGTGG No data
1179750843_1179750854 18 Left 1179750843 21:43466631-43466653 CCAAAACCCGCATTCCTATGGTT No data
Right 1179750854 21:43466672-43466694 GGCCCTCGTGGTATTTTTTCAGG No data
1179750843_1179750849 -7 Left 1179750843 21:43466631-43466653 CCAAAACCCGCATTCCTATGGTT No data
Right 1179750849 21:43466647-43466669 TATGGTTGCAGAGGCCACAAGGG No data
1179750843_1179750848 -8 Left 1179750843 21:43466631-43466653 CCAAAACCCGCATTCCTATGGTT No data
Right 1179750848 21:43466646-43466668 CTATGGTTGCAGAGGCCACAAGG No data
1179750843_1179750850 -4 Left 1179750843 21:43466631-43466653 CCAAAACCCGCATTCCTATGGTT No data
Right 1179750850 21:43466650-43466672 GGTTGCAGAGGCCACAAGGGAGG No data
1179750843_1179750851 -3 Left 1179750843 21:43466631-43466653 CCAAAACCCGCATTCCTATGGTT No data
Right 1179750851 21:43466651-43466673 GTTGCAGAGGCCACAAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179750843 Original CRISPR AACCATAGGAATGCGGGTTT TGG (reversed) Intergenic
No off target data available for this crispr