ID: 1179750844

View in Genome Browser
Species Human (GRCh38)
Location 21:43466637-43466659
Sequence CTCTGCAACCATAGGAATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179750844_1179750851 -9 Left 1179750844 21:43466637-43466659 CCCGCATTCCTATGGTTGCAGAG No data
Right 1179750851 21:43466651-43466673 GTTGCAGAGGCCACAAGGGAGGG No data
1179750844_1179750850 -10 Left 1179750844 21:43466637-43466659 CCCGCATTCCTATGGTTGCAGAG No data
Right 1179750850 21:43466650-43466672 GGTTGCAGAGGCCACAAGGGAGG No data
1179750844_1179750854 12 Left 1179750844 21:43466637-43466659 CCCGCATTCCTATGGTTGCAGAG No data
Right 1179750854 21:43466672-43466694 GGCCCTCGTGGTATTTTTTCAGG No data
1179750844_1179750852 0 Left 1179750844 21:43466637-43466659 CCCGCATTCCTATGGTTGCAGAG No data
Right 1179750852 21:43466660-43466682 GCCACAAGGGAGGGCCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179750844 Original CRISPR CTCTGCAACCATAGGAATGC GGG (reversed) Intergenic
No off target data available for this crispr