ID: 1179750849

View in Genome Browser
Species Human (GRCh38)
Location 21:43466647-43466669
Sequence TATGGTTGCAGAGGCCACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179750838_1179750849 22 Left 1179750838 21:43466602-43466624 CCTACTTGGCCGTGCCTGAAATG No data
Right 1179750849 21:43466647-43466669 TATGGTTGCAGAGGCCACAAGGG No data
1179750839_1179750849 13 Left 1179750839 21:43466611-43466633 CCGTGCCTGAAATGCCACTTCCA No data
Right 1179750849 21:43466647-43466669 TATGGTTGCAGAGGCCACAAGGG No data
1179750840_1179750849 8 Left 1179750840 21:43466616-43466638 CCTGAAATGCCACTTCCAAAACC No data
Right 1179750849 21:43466647-43466669 TATGGTTGCAGAGGCCACAAGGG No data
1179750843_1179750849 -7 Left 1179750843 21:43466631-43466653 CCAAAACCCGCATTCCTATGGTT No data
Right 1179750849 21:43466647-43466669 TATGGTTGCAGAGGCCACAAGGG No data
1179750841_1179750849 -1 Left 1179750841 21:43466625-43466647 CCACTTCCAAAACCCGCATTCCT No data
Right 1179750849 21:43466647-43466669 TATGGTTGCAGAGGCCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179750849 Original CRISPR TATGGTTGCAGAGGCCACAA GGG Intergenic
No off target data available for this crispr