ID: 1179750850

View in Genome Browser
Species Human (GRCh38)
Location 21:43466650-43466672
Sequence GGTTGCAGAGGCCACAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179750843_1179750850 -4 Left 1179750843 21:43466631-43466653 CCAAAACCCGCATTCCTATGGTT No data
Right 1179750850 21:43466650-43466672 GGTTGCAGAGGCCACAAGGGAGG No data
1179750839_1179750850 16 Left 1179750839 21:43466611-43466633 CCGTGCCTGAAATGCCACTTCCA No data
Right 1179750850 21:43466650-43466672 GGTTGCAGAGGCCACAAGGGAGG No data
1179750838_1179750850 25 Left 1179750838 21:43466602-43466624 CCTACTTGGCCGTGCCTGAAATG No data
Right 1179750850 21:43466650-43466672 GGTTGCAGAGGCCACAAGGGAGG No data
1179750841_1179750850 2 Left 1179750841 21:43466625-43466647 CCACTTCCAAAACCCGCATTCCT No data
Right 1179750850 21:43466650-43466672 GGTTGCAGAGGCCACAAGGGAGG No data
1179750844_1179750850 -10 Left 1179750844 21:43466637-43466659 CCCGCATTCCTATGGTTGCAGAG No data
Right 1179750850 21:43466650-43466672 GGTTGCAGAGGCCACAAGGGAGG No data
1179750840_1179750850 11 Left 1179750840 21:43466616-43466638 CCTGAAATGCCACTTCCAAAACC No data
Right 1179750850 21:43466650-43466672 GGTTGCAGAGGCCACAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179750850 Original CRISPR GGTTGCAGAGGCCACAAGGG AGG Intergenic
No off target data available for this crispr