ID: 1179750852

View in Genome Browser
Species Human (GRCh38)
Location 21:43466660-43466682
Sequence GCCACAAGGGAGGGCCCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179750845_1179750852 -1 Left 1179750845 21:43466638-43466660 CCGCATTCCTATGGTTGCAGAGG No data
Right 1179750852 21:43466660-43466682 GCCACAAGGGAGGGCCCTCGTGG No data
1179750844_1179750852 0 Left 1179750844 21:43466637-43466659 CCCGCATTCCTATGGTTGCAGAG No data
Right 1179750852 21:43466660-43466682 GCCACAAGGGAGGGCCCTCGTGG No data
1179750843_1179750852 6 Left 1179750843 21:43466631-43466653 CCAAAACCCGCATTCCTATGGTT No data
Right 1179750852 21:43466660-43466682 GCCACAAGGGAGGGCCCTCGTGG No data
1179750839_1179750852 26 Left 1179750839 21:43466611-43466633 CCGTGCCTGAAATGCCACTTCCA No data
Right 1179750852 21:43466660-43466682 GCCACAAGGGAGGGCCCTCGTGG No data
1179750841_1179750852 12 Left 1179750841 21:43466625-43466647 CCACTTCCAAAACCCGCATTCCT No data
Right 1179750852 21:43466660-43466682 GCCACAAGGGAGGGCCCTCGTGG No data
1179750840_1179750852 21 Left 1179750840 21:43466616-43466638 CCTGAAATGCCACTTCCAAAACC No data
Right 1179750852 21:43466660-43466682 GCCACAAGGGAGGGCCCTCGTGG No data
1179750847_1179750852 -8 Left 1179750847 21:43466645-43466667 CCTATGGTTGCAGAGGCCACAAG No data
Right 1179750852 21:43466660-43466682 GCCACAAGGGAGGGCCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179750852 Original CRISPR GCCACAAGGGAGGGCCCTCG TGG Intergenic
No off target data available for this crispr