ID: 1179750854

View in Genome Browser
Species Human (GRCh38)
Location 21:43466672-43466694
Sequence GGCCCTCGTGGTATTTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179750845_1179750854 11 Left 1179750845 21:43466638-43466660 CCGCATTCCTATGGTTGCAGAGG No data
Right 1179750854 21:43466672-43466694 GGCCCTCGTGGTATTTTTTCAGG No data
1179750847_1179750854 4 Left 1179750847 21:43466645-43466667 CCTATGGTTGCAGAGGCCACAAG No data
Right 1179750854 21:43466672-43466694 GGCCCTCGTGGTATTTTTTCAGG No data
1179750844_1179750854 12 Left 1179750844 21:43466637-43466659 CCCGCATTCCTATGGTTGCAGAG No data
Right 1179750854 21:43466672-43466694 GGCCCTCGTGGTATTTTTTCAGG No data
1179750843_1179750854 18 Left 1179750843 21:43466631-43466653 CCAAAACCCGCATTCCTATGGTT No data
Right 1179750854 21:43466672-43466694 GGCCCTCGTGGTATTTTTTCAGG No data
1179750841_1179750854 24 Left 1179750841 21:43466625-43466647 CCACTTCCAAAACCCGCATTCCT No data
Right 1179750854 21:43466672-43466694 GGCCCTCGTGGTATTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179750854 Original CRISPR GGCCCTCGTGGTATTTTTTC AGG Intergenic
No off target data available for this crispr