ID: 1179753035

View in Genome Browser
Species Human (GRCh38)
Location 21:43479329-43479351
Sequence CTGGTTCCAGAGAACAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179753035_1179753041 2 Left 1179753035 21:43479329-43479351 CCCTGTTTGTTCTCTGGAACCAG No data
Right 1179753041 21:43479354-43479376 AGCCAGGGCTTTCCACTTCCTGG No data
1179753035_1179753044 14 Left 1179753035 21:43479329-43479351 CCCTGTTTGTTCTCTGGAACCAG No data
Right 1179753044 21:43479366-43479388 CCACTTCCTGGCTGCTGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179753035 Original CRISPR CTGGTTCCAGAGAACAAACA GGG (reversed) Intergenic
No off target data available for this crispr