ID: 1179754388

View in Genome Browser
Species Human (GRCh38)
Location 21:43486493-43486515
Sequence CTCATGTCTGCTGGGTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179754388_1179754394 -9 Left 1179754388 21:43486493-43486515 CCAAGTCACCCAGCAGACATGAG No data
Right 1179754394 21:43486507-43486529 AGACATGAGGGCAGGAGAGCAGG No data
1179754388_1179754396 -4 Left 1179754388 21:43486493-43486515 CCAAGTCACCCAGCAGACATGAG No data
Right 1179754396 21:43486512-43486534 TGAGGGCAGGAGAGCAGGCTGGG No data
1179754388_1179754397 0 Left 1179754388 21:43486493-43486515 CCAAGTCACCCAGCAGACATGAG No data
Right 1179754397 21:43486516-43486538 GGCAGGAGAGCAGGCTGGGCAGG No data
1179754388_1179754395 -5 Left 1179754388 21:43486493-43486515 CCAAGTCACCCAGCAGACATGAG No data
Right 1179754395 21:43486511-43486533 ATGAGGGCAGGAGAGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179754388 Original CRISPR CTCATGTCTGCTGGGTGACT TGG (reversed) Intergenic
No off target data available for this crispr