ID: 1179759194

View in Genome Browser
Species Human (GRCh38)
Location 21:43515061-43515083
Sequence CTCCAGTGGAAGCCAGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179759194_1179759198 -7 Left 1179759194 21:43515061-43515083 CCTGGACCTGGCTTCCACTGGAG No data
Right 1179759198 21:43515077-43515099 ACTGGAGCAGAGCCCAAGGCAGG No data
1179759194_1179759203 23 Left 1179759194 21:43515061-43515083 CCTGGACCTGGCTTCCACTGGAG No data
Right 1179759203 21:43515107-43515129 CTACGCATAAAGCTCTGTTGTGG No data
1179759194_1179759199 -6 Left 1179759194 21:43515061-43515083 CCTGGACCTGGCTTCCACTGGAG No data
Right 1179759199 21:43515078-43515100 CTGGAGCAGAGCCCAAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179759194 Original CRISPR CTCCAGTGGAAGCCAGGTCC AGG (reversed) Intergenic
No off target data available for this crispr