ID: 1179760247

View in Genome Browser
Species Human (GRCh38)
Location 21:43522021-43522043
Sequence CCTCACCTGCAGAGTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179760243_1179760247 5 Left 1179760243 21:43521993-43522015 CCGCAACTCTGTCACTAGAGTCC No data
Right 1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG No data
1179760242_1179760247 25 Left 1179760242 21:43521973-43521995 CCAAGAGGCACAGACTGTAACCG No data
Right 1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179760247 Original CRISPR CCTCACCTGCAGAGTGTGGC TGG Intergenic
No off target data available for this crispr