ID: 1179761016

View in Genome Browser
Species Human (GRCh38)
Location 21:43528796-43528818
Sequence AAGGCAACTCTCACCAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179761012_1179761016 26 Left 1179761012 21:43528747-43528769 CCAAGTCCCAGGCATTTCTTTAC 0: 3
1: 16
2: 478
3: 3145
4: 9960
Right 1179761016 21:43528796-43528818 AAGGCAACTCTCACCAATCATGG No data
1179761013_1179761016 20 Left 1179761013 21:43528753-43528775 CCCAGGCATTTCTTTACAGCAGT No data
Right 1179761016 21:43528796-43528818 AAGGCAACTCTCACCAATCATGG No data
1179761014_1179761016 19 Left 1179761014 21:43528754-43528776 CCAGGCATTTCTTTACAGCAGTG No data
Right 1179761016 21:43528796-43528818 AAGGCAACTCTCACCAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179761016 Original CRISPR AAGGCAACTCTCACCAATCA TGG Intergenic
No off target data available for this crispr