ID: 1179763967

View in Genome Browser
Species Human (GRCh38)
Location 21:43555289-43555311
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 2, 1: 0, 2: 4, 3: 34, 4: 278}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179763967_1179763976 6 Left 1179763967 21:43555289-43555311 CCCCACACCATCCCTGCAGATGG 0: 2
1: 0
2: 4
3: 34
4: 278
Right 1179763976 21:43555318-43555340 ATGTATTTTCATGAGCTCCAAGG 0: 2
1: 0
2: 2
3: 16
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179763967 Original CRISPR CCATCTGCAGGGATGGTGTG GGG (reversed) Intronic
900175809 1:1290885-1290907 CCGTCTGCAGGGATGGACTCTGG + Exonic
900338803 1:2178024-2178046 TCCTCAGCAGGGTTGGTGTGGGG + Intronic
900593112 1:3468556-3468578 CCATCTGCCGGGAAGATCTGTGG + Intronic
900819733 1:4877313-4877335 CCTTCTGCAGGTGGGGTGTGGGG + Intergenic
900991619 1:6100753-6100775 CCATCTACAGGGAGGATGTGAGG + Exonic
903186638 1:21633014-21633036 CCAGCTGGAGGGGTGGTGAGAGG + Intronic
904355001 1:29933294-29933316 CTAGATGCAGGGAGGGTGTGTGG + Intergenic
904440497 1:30526546-30526568 GCATCTGCAGGGCAGGGGTGGGG + Intergenic
907593834 1:55701599-55701621 CCAGCAGCAGGTATGGTGTGTGG + Intergenic
907936439 1:59046270-59046292 CCATGTGCTGGGATGGGGAGAGG + Intergenic
908133971 1:61109308-61109330 CCATCTGTAGAGATGGAGGGGGG - Intronic
908259381 1:62327671-62327693 GAGTCTGCAGGGATGATGTGTGG + Intergenic
909067630 1:70954508-70954530 CCATTTGCAGGATTGCTGTGAGG - Intronic
909282084 1:73769853-73769875 ACCACTGCAGGGAGGGTGTGGGG + Intergenic
914245954 1:145885964-145885986 TCCTCTGCAGGGATGGGGTAGGG - Intergenic
915421847 1:155789119-155789141 GCCTCTGAAGGGATGGTGTGGGG + Intronic
917094769 1:171389105-171389127 CCATCTCCAGGCATTGTGAGAGG - Intergenic
917797233 1:178541444-178541466 CCACCTGGAGAGCTGGTGTGGGG - Intronic
918821385 1:189259892-189259914 CTTTCTGGAGGGCTGGTGTGGGG + Intergenic
919515039 1:198511762-198511784 CCCTCCGGAGGGATGGTGAGGGG + Intergenic
921991439 1:221371932-221371954 CCATCTCCAGGGAATGTGAGAGG - Intergenic
922815545 1:228446467-228446489 CCATCTGGGGAGAAGGTGTGCGG - Intergenic
922851507 1:228736939-228736961 TCAGCTGCAGGGGTGGGGTGGGG - Intronic
923456440 1:234169388-234169410 CCATCTGCTGGGCTGAGGTGAGG - Intronic
924184534 1:241474429-241474451 GCATCTGCAGGGTTGGTGGTGGG - Intergenic
1062864105 10:835363-835385 TCCTCTGCAGAGAAGGTGTGTGG + Intronic
1063369997 10:5514949-5514971 CCATCTGCGGGGAAGCAGTGAGG + Intergenic
1064886167 10:20114787-20114809 ACATCTGGAGGGGTGGTGAGAGG + Intronic
1066342473 10:34549566-34549588 ACAACTGCATGGATGGGGTGGGG - Intronic
1066561162 10:36671309-36671331 CCATCTTCAGAGGTGCTGTGTGG - Intergenic
1067279798 10:44862550-44862572 AGATCTGCAGGGGTTGTGTGTGG - Intergenic
1067701166 10:48573522-48573544 CCATCTGAAGGGCTGGTCTCAGG + Intronic
1068197213 10:53732319-53732341 CTATGTGCAGGAGTGGTGTGGGG + Intergenic
1068702285 10:60032966-60032988 CCATCTGATGGGAAGGTGTGAGG + Intronic
1069572166 10:69500885-69500907 CCTGGTGCAGGGATGCTGTGGGG - Intronic
1069717631 10:70531160-70531182 CAGGTTGCAGGGATGGTGTGGGG + Intronic
1070808683 10:79286348-79286370 ACATCAGCAGGGCTGCTGTGGGG + Intronic
1071208540 10:83312048-83312070 CCAGGTGCAGGGTTGGAGTGGGG - Intergenic
1071433611 10:85626106-85626128 CCAGGTGCAGGGTAGGTGTGGGG + Intronic
1071885836 10:89950041-89950063 CCAGCTGCAAGCATGGTGTCTGG - Intergenic
1072717155 10:97759772-97759794 CAATCAGCAGAGATGGGGTGTGG - Exonic
1073107213 10:101039089-101039111 CTATCTCCAAGGATGGGGTGGGG + Intronic
1073516585 10:104081435-104081457 CCCTCAGCATGGATGGTATGAGG + Intronic
1074110274 10:110417783-110417805 CCAGCTGCAGGGATGGATTGGGG + Intergenic
1074331951 10:112521900-112521922 CCTGGTGCAGGGGTGGTGTGTGG + Intronic
1074549931 10:114433378-114433400 CCAGCTGGAGGGATGGGTTGTGG - Intronic
1075407722 10:122205673-122205695 CCTTCTGCAGGGCTGGGGTGGGG - Intronic
1075679452 10:124322018-124322040 CCATCTGCAGGGACAGGGTGTGG - Intergenic
1076014805 10:127019057-127019079 CCAGCTGCAAGGATTGTGTGAGG + Intronic
1077134195 11:990671-990693 CCAGCTGAAAGGATGGGGTGAGG - Intronic
1077134204 11:990705-990727 CCAGCTGAAAGGATGGGGTGGGG - Intronic
1077134242 11:990810-990832 CCAGCTGAAAGGATGGGGTGAGG - Intronic
1077134252 11:990845-990867 CCAGCTGAAAGGATGGGGTGGGG - Intronic
1077134264 11:990880-990902 CCAGCTGAAAGGATGGGGTGGGG - Intronic
1077314822 11:1914144-1914166 CCATGTGCAGGCCTGCTGTGGGG + Intergenic
1077533134 11:3106574-3106596 TCATCTGCAGGCATGCTCTGGGG + Intronic
1078725209 11:13923976-13923998 CCACCTGTGGGGATGGGGTGTGG - Intergenic
1079882288 11:25943559-25943581 CTCTCTGCAGGGAGGTTGTGGGG + Intergenic
1080935119 11:36855101-36855123 CTATGTGCAGGGAGGGTGGGAGG + Intergenic
1083641533 11:64148308-64148330 CCAGCTGCAGGGATGTGGAGGGG - Intronic
1083813688 11:65119821-65119843 CCATCTCCAGGGCTGCTGTGAGG - Intergenic
1083994891 11:66267003-66267025 CCATGCGCAGGGCTGGGGTGAGG - Exonic
1084398662 11:68931232-68931254 GACCCTGCAGGGATGGTGTGGGG + Intronic
1084706652 11:70819807-70819829 GCAGCTGCAGGGATGGTCTCAGG - Intronic
1085375000 11:76052411-76052433 GCAGCTGCAGGGATGTGGTGAGG - Intronic
1086155880 11:83665516-83665538 CCCTCTGCAGGGATGACCTGAGG + Intronic
1087459692 11:98430258-98430280 CGATCTGCAGGGATGGTTTTGGG - Intergenic
1088522589 11:110714997-110715019 CCATGTGTATGGTTGGTGTGTGG - Intergenic
1088910127 11:114184493-114184515 CCATCTGCAAAGATGTTTTGTGG - Intronic
1089705142 11:120272370-120272392 CTCTCCCCAGGGATGGTGTGTGG - Intronic
1094191610 12:27703855-27703877 CTGTCTGCAGGAATGCTGTGTGG + Intergenic
1097042493 12:56164238-56164260 CCACCTGGAGGGAGGGTGAGCGG - Intronic
1097884633 12:64716715-64716737 CCATCTGCAGAGGCTGTGTGAGG + Exonic
1099991778 12:89730085-89730107 CCAGCTGCAGCAATGGTTTGGGG - Intergenic
1104592894 12:130098833-130098855 CCACCTCCTGGGATGCTGTGAGG + Intergenic
1104906012 12:132213948-132213970 CATGCTGCAGGGAGGGTGTGCGG - Intronic
1105279432 13:18954571-18954593 CCACCTGCAGGGCAGGTTTGAGG - Intergenic
1105424407 13:20282626-20282648 AAACCTGCAGGGATGGTGGGGGG - Intergenic
1105546285 13:21353057-21353079 CCCTCTGCAGGGCCCGTGTGTGG + Intergenic
1105993798 13:25650126-25650148 CCAACTTGAGGGATGGGGTGGGG + Intronic
1106790931 13:33154144-33154166 CCATCCACAGGGAGGGTGTCGGG + Intronic
1107603607 13:42038509-42038531 CCATTGGCAGGGCTGATGTGGGG + Intergenic
1107717688 13:43216875-43216897 CCAGCTGCAGGGCTGCTGGGTGG - Intronic
1110239015 13:73246228-73246250 GCATCTACAGGGTTGGGGTGGGG + Intergenic
1111183710 13:84701313-84701335 GGACCTGCAGGGATGGTTTGGGG + Intergenic
1111450745 13:88411885-88411907 CAAGCGACAGGGATGGTGTGTGG - Intergenic
1113871881 13:113564810-113564832 TCATCTGAGGGGATGGTCTGAGG - Intergenic
1113926167 13:113942926-113942948 CCATCTGCAGTGCTCGTGAGGGG - Intergenic
1114790397 14:25651328-25651350 CCATATGCATGGAGGGTGAGGGG - Intergenic
1115305228 14:31927090-31927112 CCATCTACAGCTATGGTGGGAGG - Intergenic
1115782294 14:36783245-36783267 CCAGCTACAGGGTTGGGGTGGGG + Intronic
1118971082 14:70638734-70638756 CCCTCTCCAGGGATAATGTGAGG + Intergenic
1119656559 14:76421307-76421329 CCATGTGCATGGAAGGTGTGGGG + Intronic
1120852968 14:89187464-89187486 CCAGCCACAGTGATGGTGTGTGG - Intronic
1121259816 14:92557922-92557944 ACATGTGCAGGGCAGGTGTGTGG + Intronic
1121650342 14:95553375-95553397 CCCTCTGCGGGAAGGGTGTGGGG + Intergenic
1122632061 14:103111661-103111683 CCATCTCCAGGGCTGGGGTGGGG + Intergenic
1122796225 14:104207527-104207549 CCATTTGGGGGGATGCTGTGAGG + Intergenic
1124235258 15:27984463-27984485 CCATCTGCTGAGGTGGTGGGAGG - Intronic
1126446535 15:48752280-48752302 CCATCTGAAGGGTTGCTTTGAGG - Intronic
1128412212 15:67411022-67411044 GCATGTGCAGGGGTGGGGTGGGG - Intronic
1128441827 15:67717208-67717230 CCAGCTACAGGGATAGTGTAAGG - Intronic
1128470321 15:67946221-67946243 CAAACTGCAGGGAGAGTGTGTGG + Intergenic
1129978643 15:79846161-79846183 CCAACTGCAGTAAGGGTGTGTGG + Intronic
1131014985 15:89050644-89050666 CCATCTGCTGGGATGGGAGGTGG + Intergenic
1131027350 15:89155704-89155726 CCATCTCAAAGGCTGGTGTGAGG - Intronic
1133465988 16:6027524-6027546 CCATTTGTAGGGATGGACTGAGG - Intronic
1134104400 16:11475679-11475701 TCATCACCAGGGATGGCGTGAGG - Exonic
1134771768 16:16815276-16815298 CCATGTGCAGGAATGGCCTGGGG + Intergenic
1135600583 16:23780003-23780025 CCCTCTCCAGAAATGGTGTGTGG - Intergenic
1135953874 16:26939618-26939640 CCAACTTCAGTGATTGTGTGTGG + Intergenic
1139649460 16:68355145-68355167 CACTCTGCAGGTGTGGTGTGGGG - Intronic
1139698404 16:68691940-68691962 CCATCCTCAGGGAGGGGGTGGGG - Intronic
1141151506 16:81567558-81567580 ACACCTTCAGGGATGGTGTGAGG + Intronic
1142287710 16:89178138-89178160 CCATCTGAGGGGTGGGTGTGGGG + Intronic
1144061177 17:11583996-11584018 GCTGCTGCAGGGAGGGTGTGGGG - Intergenic
1144495229 17:15741568-15741590 CCATCTGTAGGGAGGGAGGGTGG - Intronic
1144580588 17:16456882-16456904 CCATCTTCAGGGATCGGGGGAGG - Intronic
1145216150 17:21054138-21054160 TCCTCTGCAGGGAGGCTGTGGGG + Intergenic
1146453203 17:32990987-32991009 GCATGTGCAGGGATGGTGGTGGG - Intronic
1146517555 17:33501149-33501171 GCATCTCCAGGGATTGAGTGTGG - Intronic
1146548075 17:33756296-33756318 CCATCTGAGGGGCTGGTGTTTGG - Intronic
1147185857 17:38712803-38712825 CCTTCAGGAGGGATGGTGTGTGG + Intronic
1147311139 17:39596810-39596832 CCAGCTGCGGGGGTGGTGGGGGG - Intergenic
1147845615 17:43402225-43402247 CCAGCTACAGGGATGGGGAGGGG - Intergenic
1148647542 17:49227797-49227819 CCTTCTGCAGGGATGGAATGCGG + Intronic
1150957563 17:69877273-69877295 CCTTCTGCCATGATGGTGTGAGG - Intergenic
1151333033 17:73422431-73422453 GCATCTGCAGGGACAGTGAGTGG + Exonic
1152184532 17:78846152-78846174 CCATCTGCAGGGTTCGGATGAGG - Intergenic
1152257567 17:79249004-79249026 CCATCGGCTGGGATGCGGTGCGG + Intronic
1152684554 17:81687649-81687671 ACATCTGCAGGGATTGTGCTGGG + Intronic
1153139558 18:1955267-1955289 GCTGCTGCAGGGATGGTGTAGGG - Intergenic
1155433567 18:25787498-25787520 ACAGCTGCAGTGGTGGTGTGGGG + Intergenic
1155896507 18:31335171-31335193 TAATTTGCAGGGATGCTGTGAGG - Intronic
1157618485 18:49001847-49001869 CTATCTTGAGGGCTGGTGTGAGG + Intergenic
1158273648 18:55743100-55743122 CCATCTAAAAGGAAGGTGTGTGG + Intergenic
1160239311 18:77111735-77111757 CTCTCTGCAGGGAGGGTGGGCGG - Intronic
1160510530 18:79451083-79451105 CCACCTGCAGGGACAGCGTGCGG - Exonic
1160989304 19:1854057-1854079 CAATCTGCAGGGATGGGGCAGGG + Exonic
1161349396 19:3783774-3783796 CCCACTGCAGGGACGGGGTGGGG + Intronic
1165792584 19:38500802-38500824 CCATCTGCAGGCAGGGAGGGTGG - Exonic
1166276154 19:41755649-41755671 CAATCTGCAGGGAGGGGCTGAGG - Exonic
1166423224 19:42654210-42654232 CCATCTGCAGGGAGGAGCTGAGG - Intronic
1166769382 19:45271769-45271791 CCCTCTGCAGGGGAGGTGTGGGG - Intronic
1167247307 19:48381365-48381387 CCCTCTGTAGGGATGCTGTGAGG + Intergenic
925132189 2:1501948-1501970 TGAACTGCAGGGATGGGGTGAGG + Intronic
925878714 2:8333006-8333028 TCACCTGCAGGGGTGGGGTGGGG - Intergenic
926203706 2:10819986-10820008 CTAACTGCAGGGCTGCTGTGAGG - Intronic
927448896 2:23189498-23189520 CCAGGTGCAGTGATGGGGTGGGG - Intergenic
927725510 2:25419407-25419429 CCCTCTTCAGAGATGATGTGCGG + Intronic
928450559 2:31374715-31374737 ACAACTGCAGAGATGGAGTGTGG - Intronic
930208282 2:48609762-48609784 CCATCTGCAGGGGTGGTGGTAGG + Intronic
931223505 2:60309385-60309407 CCATCTGCAGGGATGGAACTTGG + Intergenic
931249204 2:60515282-60515304 CCCTGTCCAGGGAAGGTGTGAGG - Intronic
931470183 2:62531735-62531757 CATTCTGCAGGGGTGGTCTGTGG + Intergenic
931811220 2:65856824-65856846 ACATCTTCAGTGATGCTGTGTGG + Intergenic
933452379 2:82471667-82471689 CCATATGTATGGCTGGTGTGTGG - Intergenic
933779338 2:85790690-85790712 CCATGTGCAGGGACTGTGTTGGG + Intergenic
934757384 2:96833460-96833482 GCACCTGCAGGGAGGCTGTGGGG - Exonic
936009498 2:108916469-108916491 ACATCTGCAGGCATTGTTTGGGG - Intronic
936155876 2:110047259-110047281 CCACCTCCAGGGCTGCTGTGGGG - Intergenic
936188812 2:110324169-110324191 CCACCTCCAGGGCTGCTGTGGGG + Intergenic
936561914 2:113546676-113546698 CCATCATCAGTGATGGTGAGAGG + Intergenic
936987013 2:118321090-118321112 CCATTTGCAGTGAAGGTGTCTGG + Intergenic
938725593 2:134106166-134106188 CCAGCTGAAGGGGTGGGGTGGGG - Intergenic
942053658 2:172163097-172163119 ACTGCTGCAGGGAGGGTGTGGGG - Intergenic
942574771 2:177351822-177351844 ACATCAGCTGGGGTGGTGTGTGG + Intronic
946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG + Exonic
946335276 2:219031544-219031566 GCAGCTGCAGGGATGGTGGGCGG + Exonic
948783219 2:240337492-240337514 TCATGTGCTGGGATGGTGGGGGG - Intergenic
949075265 2:242053303-242053325 CCAGCAGCAGGGATGGGATGGGG + Intergenic
1170380646 20:15756078-15756100 CCAAGAGCAGGGATGGTGTGTGG - Intronic
1170600681 20:17839093-17839115 CTATATGGAGGGATGATGTGTGG - Intergenic
1173400156 20:42718996-42719018 ACATATGCAGGGATGGAGTAGGG + Intronic
1174449587 20:50611010-50611032 CCTTCCTCAGGGATGGTGAGGGG - Intronic
1175173269 20:57094202-57094224 TCATCTGCAGGGAAGGTCTGAGG - Intergenic
1175506849 20:59492158-59492180 TCATCGGCAGGGATGGTGTGAGG - Intergenic
1176359551 21:5983261-5983283 CCATCTGCAGGGATGGTGTGGGG + Intergenic
1176687744 21:9866149-9866171 CCATCTGCAGTGGTGGTTGGTGG + Intergenic
1178270636 21:31186418-31186440 CCATCTTCTAGGATGGTGTGGGG - Intronic
1178973221 21:37199536-37199558 CCATGGGCAGGGTTGGTGTCGGG - Intronic
1179763967 21:43555289-43555311 CCATCTGCAGGGATGGTGTGGGG - Intronic
1179812390 21:43880340-43880362 GCATCTGCAGGGGCGGGGTGGGG + Intronic
1180670331 22:17548227-17548249 CAGTCTGCAGGGGAGGTGTGGGG - Exonic
1180885584 22:19241025-19241047 CCGGCTGCAGGGTGGGTGTGGGG - Intronic
1181449923 22:23012910-23012932 CCACGGGCAGGCATGGTGTGTGG - Intergenic
1182162824 22:28140124-28140146 CTCTCTGCAGGGTTGTTGTGAGG + Intronic
1182301161 22:29337873-29337895 GCGTCTGCAGGGAAGGGGTGGGG - Intronic
1183316218 22:37138469-37138491 CCATCTCCAGGGAAGCAGTGGGG - Intronic
1183948145 22:41338425-41338447 CCATCTACAGGGCTGGGATGGGG - Intronic
1184557320 22:45240458-45240480 CCAGATGCAGGGACGGTGGGGGG + Intronic
949120544 3:378770-378792 TCATCAGAAGGAATGGTGTGAGG - Intronic
950443496 3:13023181-13023203 CTCTCTGTAGGGATGGAGTGGGG + Intronic
953032861 3:39189397-39189419 CCATCCTCATGGTTGGTGTGGGG + Exonic
953063052 3:39443729-39443751 CCCTCTGCAGGGAGGGAATGGGG + Intergenic
961735437 3:128999444-128999466 CCAGCTGCAGGGATGGGGGGTGG + Intronic
961829840 3:129617820-129617842 CCATCTGCAAGTCTGGGGTGAGG + Intergenic
962422159 3:135238332-135238354 CCACCTGCTGGGATGGAGGGGGG + Intronic
962707503 3:138059530-138059552 CCATCTCAAGGGCTGCTGTGAGG + Intergenic
963619356 3:147586158-147586180 ACATCTGCTGGGAAGGTGTTTGG + Intergenic
964752897 3:160068589-160068611 CCTTCTAAAGGGATGGTGTTAGG + Intergenic
966934722 3:184698465-184698487 CCAGCTGGTAGGATGGTGTGTGG + Intergenic
967007741 3:185400181-185400203 ACATCAGCAGGGCTGGTGAGAGG - Intronic
967835435 3:193958655-193958677 CCATTTCCAGGGAGGTTGTGTGG + Intergenic
968309575 3:197672498-197672520 CGATCTAAAGGGATGGGGTGCGG + Intronic
969439194 4:7207418-7207440 CCAGCTGCTGGGCTGGAGTGTGG + Intronic
969502670 4:7562802-7562824 GCAGCTGCAGAGATGGAGTGGGG - Intronic
969590805 4:8121046-8121068 CCACCTGCAGGGATGGCGTGTGG - Intronic
971285404 4:25284641-25284663 CCTGTTGCAGGGATGGTATGGGG - Intergenic
972727076 4:41754101-41754123 ACATCTGCTGGGCTGGTGGGGGG + Intergenic
976290689 4:83414352-83414374 CCATCCACAGGGGTGCTGTGGGG + Intronic
977710334 4:100117173-100117195 CCATCTGCTGGCATGGCATGAGG + Intergenic
980351098 4:131683963-131683985 CCATCTGCAGTGGTGGTTGGTGG + Intergenic
982161802 4:152577864-152577886 ACATCTGTAGGGTTGTTGTGAGG - Intergenic
986182876 5:5409733-5409755 TCAGCTGCAGGACTGGTGTGAGG + Intergenic
988136127 5:27174118-27174140 CCATGTCAAGGGATGGTGTTGGG - Intergenic
988594810 5:32581748-32581770 CCTTCCCCAGGGCTGGTGTGGGG + Intronic
992015047 5:72567049-72567071 CCTTCTGAAGGGACGGTATGGGG + Intergenic
992202161 5:74395284-74395306 CCACCTGCTGGCATGCTGTGTGG - Intergenic
992226312 5:74622410-74622432 CCATCTGAAGGGTGGGTGGGGGG - Intergenic
995675366 5:114657157-114657179 CTATCTGCAGGCATTGTGTGAGG + Intergenic
997440807 5:133907460-133907482 CCATTTGCAGAGATTATGTGAGG - Intergenic
998238713 5:140423005-140423027 CCAGCTGCAGGGGTGGGGTGTGG - Intronic
1001251958 5:170153415-170153437 CCCTCAGCAGGGGTCGTGTGTGG - Intergenic
1001263790 5:170257054-170257076 GCATTTGCAGGGCTGGGGTGGGG + Intronic
1005057264 6:21741345-21741367 CCATATGCTGGGGTGGAGTGGGG + Intergenic
1005868589 6:29956783-29956805 CTACCTGCAGGGAAGGTGGGCGG + Intergenic
1005872560 6:29985800-29985822 TCAGCTGCAGGCCTGGTGTGGGG - Intergenic
1006747203 6:36351536-36351558 CCCTCTCCAGGCATGGTGGGTGG - Intergenic
1006979162 6:38132724-38132746 ACATCTGCATGGAGGGAGTGTGG + Intronic
1007425200 6:41742084-41742106 ACAGGTGCAGGGATGGGGTGTGG + Intronic
1007911160 6:45515351-45515373 TCATCTTCAGGGTTGGTGTGAGG + Intronic
1008029066 6:46672671-46672693 TCATCTGCAGGGAAGATTTGGGG + Intronic
1011542344 6:88445354-88445376 CCATCTGGACAGATGGAGTGTGG - Intergenic
1011650785 6:89504274-89504296 CCAGCTGATGGGATGCTGTGAGG + Intronic
1013180445 6:107712791-107712813 CCAGCTGCAGCGAAGGTGTCAGG + Intronic
1014413345 6:121153452-121153474 CCATCTGGAGGTATGGGGTCAGG + Intronic
1014433527 6:121396950-121396972 TCATCTGCCGGAATGGGGTGAGG - Intergenic
1016813588 6:148283443-148283465 CCATGTGCTGTGATGCTGTGTGG - Intronic
1018200332 6:161388501-161388523 CCATCCACAAGTATGGTGTGTGG + Intronic
1018995881 6:168710121-168710143 GCATCTGCAGGTGTGGTGTTTGG - Intergenic
1019401054 7:854047-854069 CCCACTGCAGGGATCGCGTGGGG + Intronic
1020111873 7:5452078-5452100 CCACCTGGAGGGAGGCTGTGTGG + Intronic
1020465824 7:8477675-8477697 CCTGCTGCAGGGATGGTGCTGGG + Intronic
1020726368 7:11820184-11820206 CAATCTGCATGGCTGGTGAGGGG + Intronic
1021757197 7:23863427-23863449 GCATCTGCAGGGAGGGTTTTAGG + Intergenic
1022001715 7:26232344-26232366 CTATCTTCAGGGATGGAGTAAGG + Intergenic
1022109444 7:27219544-27219566 CCAGCTGCAGGGATGGGGAGGGG + Intergenic
1023516739 7:41008891-41008913 CCACCCGAAGGGATGGTGTCTGG + Intergenic
1023890238 7:44386709-44386731 GCATCTGCAAGGATGCAGTGGGG - Intronic
1024462306 7:49670991-49671013 ACGTCTGCCAGGATGGTGTGTGG - Intergenic
1029101031 7:98130131-98130153 CCATCTGGAAGGATGGAGAGAGG + Intronic
1029262786 7:99314751-99314773 CCATCTGCCGGGGCGGGGTGGGG - Intergenic
1029490328 7:100867118-100867140 CCACGTGCAGGGCTGGGGTGCGG + Exonic
1030964014 7:115966295-115966317 CTAGCGGCAGGGAGGGTGTGAGG + Intronic
1033285758 7:140039357-140039379 CCATCTGCAGGGATTTTGACTGG - Intronic
1033362323 7:140646549-140646571 TCATCTGGAGAGCTGGTGTGGGG + Intronic
1034296423 7:149976791-149976813 CCTTTTACAGGAATGGTGTGAGG + Intergenic
1035692690 8:1570655-1570677 ACATCTGCTGGGATGGAGGGAGG + Intronic
1036739695 8:11348780-11348802 CCAGCTTCAGGGTTGCTGTGAGG + Intergenic
1037373571 8:18205538-18205560 CCATCTGCAGTGATGGTTTGCGG + Intronic
1037501230 8:19487297-19487319 CCAACAGCAGCGATGGTGTCTGG + Intronic
1037707490 8:21327366-21327388 CTTTCTGCTGGGAAGGTGTGGGG - Intergenic
1037760650 8:21739418-21739440 TTATCGGCAGGGATAGTGTGAGG + Intronic
1037913638 8:22758990-22759012 CCATCTGCAGGGAGGGGGCGAGG + Intronic
1038013540 8:23494098-23494120 CCAGCAGCAGGGAGGGTGGGTGG - Intergenic
1038297794 8:26311926-26311948 ACATCTGAAGGGATGGTGTCAGG + Intronic
1040457147 8:47610218-47610240 GCAGCTGCAGGAATGGGGTGGGG - Intronic
1040550711 8:48435048-48435070 ACAGCTGCAGGGATGGTGCTGGG + Intergenic
1044343682 8:91077594-91077616 ACATATGCAAGGATGGAGTGGGG - Intronic
1044386679 8:91597469-91597491 TCCTCTGCAGGGCTGCTGTGAGG + Intergenic
1044715211 8:95093853-95093875 CCCTTTGCAGGGAAGATGTGTGG - Intronic
1044803757 8:95983709-95983731 CCAGCTGCAGGAATGGCCTGAGG + Intergenic
1047993585 8:130312320-130312342 TCAGCTGCAGGGATGGTGGATGG - Intronic
1049202407 8:141346745-141346767 CCATCTGCAAGGCTGGCATGGGG + Intergenic
1049276914 8:141724579-141724601 CAATCCGCAGGGTTGTTGTGGGG + Intergenic
1049431999 8:142569525-142569547 CCATGGGCAGGGGTGGTGGGTGG - Intergenic
1049690703 8:143957704-143957726 CCATTCGCAGGTGTGGTGTGGGG - Intronic
1051868438 9:21708895-21708917 CCAGCTGCAGGGATGCAGTGGGG + Intergenic
1052337161 9:27331631-27331653 TCATCTCCAAGGATGGTCTGAGG + Intronic
1053781612 9:41615750-41615772 CCATCTGCAGTGGTGGTTGGTGG - Intergenic
1053792365 9:41695880-41695902 CCCTCAGCAGGGTTGGGGTGGGG - Intergenic
1054169560 9:61825904-61825926 CCATCTGCAGTGGTGGTTGGTGG - Intergenic
1054180774 9:61907900-61907922 CCCTCAGCAGGGTTGGGGTGGGG - Intergenic
1054472583 9:65550088-65550110 CCCTCGGCAGGGTTGGGGTGGGG + Intergenic
1054656817 9:67673242-67673264 CCCTCAGCAGGGTTGGGGTGGGG + Intergenic
1054667978 9:67754911-67754933 CCATCTGCAGTGGTGGTTGGTGG + Intergenic
1056557248 9:87699966-87699988 CCAACAGCAGGGATGGGGAGGGG + Intronic
1056679814 9:88706991-88707013 GCCACTGCAGGGTTGGTGTGGGG + Intergenic
1057754401 9:97820333-97820355 CCATCTGCAGGGTTGCTGGGAGG - Intergenic
1057799388 9:98180902-98180924 CCAGCTCCAGGGATGGTGTGGGG + Intronic
1057817164 9:98304221-98304243 CGGTCTGGAGGGATGGTGGGGGG + Intronic
1060268758 9:122127108-122127130 CCATCTGCCGGGCTGGGGTGTGG - Intergenic
1060742627 9:126109642-126109664 CCATGTGCAAGGAAGCTGTGTGG - Intergenic
1060931199 9:127490504-127490526 CCATCTGCAGTGAGAATGTGGGG - Intronic
1060969958 9:127732275-127732297 CCATCTGCAGGAAGGGTAGGTGG + Exonic
1061225533 9:129278928-129278950 CCTTCTGCAGGGCAGATGTGAGG - Intergenic
1061370157 9:130193404-130193426 ACAGCAGCTGGGATGGTGTGGGG + Intronic
1061836618 9:133333803-133333825 CCATCTGCAGGGAAGGAGACAGG + Exonic
1062201005 9:135302610-135302632 CCAGCTCCAGGACTGGTGTGAGG - Intergenic
1062277866 9:135739206-135739228 CCTCCCTCAGGGATGGTGTGGGG - Intronic
1062280269 9:135748816-135748838 CCTCCCTCAGGGATGGTGTGGGG - Intronic
1062308333 9:135921947-135921969 GCATCTGCAGGGCTGGTCTGGGG - Intergenic
1186424252 X:9451277-9451299 CCAACTGCATGGATGTTGGGCGG - Intergenic
1188237946 X:27752114-27752136 CCATCTCCAGGGCTGGGCTGAGG - Intergenic
1188820660 X:34770845-34770867 CCATCTGGAAGGAGGGTGGGAGG - Intergenic
1189291337 X:39887983-39888005 GCATCTGTAGGGATGGTGGGTGG + Intergenic
1190742589 X:53299682-53299704 CCATCTGCAGGGATGCAGCTGGG + Intronic
1191895639 X:65989631-65989653 TCATTCTCAGGGATGGTGTGAGG - Intergenic
1196098330 X:111823346-111823368 CCATCTTCAGGGAAGGAGGGAGG - Intronic
1200254575 X:154573260-154573282 CAATCTGCAGAGCTGGGGTGGGG - Intergenic
1200263194 X:154631148-154631170 CAATCTGCAGAGCTGGGGTGGGG + Intergenic
1201060377 Y:10038733-10038755 ACATCTGCATGGAGGGTGAGAGG - Intergenic
1201966428 Y:19741438-19741460 CCATCTGCAAGGATCGTCGGTGG - Exonic
1202161812 Y:21941869-21941891 ACATCTGCATGGAGGGTGAGAGG - Intergenic
1202229544 Y:22644504-22644526 ACATCTGCATGGAGGGTGAGAGG + Intergenic
1202313612 Y:23551661-23551683 ACATCTGCATGGAGGGTGAGAGG - Intergenic
1202557191 Y:26118934-26118956 ACATCTGCATGGAGGGTGAGAGG + Intergenic