ID: 1179764835

View in Genome Browser
Species Human (GRCh38)
Location 21:43564407-43564429
Sequence GTGGAGCTACCCAAGGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179764835_1179764850 29 Left 1179764835 21:43564407-43564429 CCCATGGCCTTGGGTAGCTCCAC No data
Right 1179764850 21:43564459-43564481 TCCTGGCTGCTTTCATGGGCTGG No data
1179764835_1179764839 -5 Left 1179764835 21:43564407-43564429 CCCATGGCCTTGGGTAGCTCCAC No data
Right 1179764839 21:43564425-43564447 TCCACCCCTGTGGCTTTGCAAGG No data
1179764835_1179764847 24 Left 1179764835 21:43564407-43564429 CCCATGGCCTTGGGTAGCTCCAC No data
Right 1179764847 21:43564454-43564476 CCCTCTCCTGGCTGCTTTCATGG No data
1179764835_1179764849 25 Left 1179764835 21:43564407-43564429 CCCATGGCCTTGGGTAGCTCCAC No data
Right 1179764849 21:43564455-43564477 CCTCTCCTGGCTGCTTTCATGGG No data
1179764835_1179764844 12 Left 1179764835 21:43564407-43564429 CCCATGGCCTTGGGTAGCTCCAC No data
Right 1179764844 21:43564442-43564464 GCAAGGTATAGCCCCTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179764835 Original CRISPR GTGGAGCTACCCAAGGCCAT GGG (reversed) Intronic