ID: 1179764836

View in Genome Browser
Species Human (GRCh38)
Location 21:43564408-43564430
Sequence GGTGGAGCTACCCAAGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3601
Summary {0: 7, 1: 120, 2: 603, 3: 1174, 4: 1697}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179764836_1179764839 -6 Left 1179764836 21:43564408-43564430 CCATGGCCTTGGGTAGCTCCACC 0: 7
1: 120
2: 603
3: 1174
4: 1697
Right 1179764839 21:43564425-43564447 TCCACCCCTGTGGCTTTGCAAGG 0: 437
1: 796
2: 1347
3: 1428
4: 1389
1179764836_1179764847 23 Left 1179764836 21:43564408-43564430 CCATGGCCTTGGGTAGCTCCACC 0: 7
1: 120
2: 603
3: 1174
4: 1697
Right 1179764847 21:43564454-43564476 CCCTCTCCTGGCTGCTTTCATGG 0: 30
1: 166
2: 534
3: 723
4: 977
1179764836_1179764844 11 Left 1179764836 21:43564408-43564430 CCATGGCCTTGGGTAGCTCCACC 0: 7
1: 120
2: 603
3: 1174
4: 1697
Right 1179764844 21:43564442-43564464 GCAAGGTATAGCCCCTCTCCTGG 0: 3
1: 20
2: 97
3: 375
4: 903
1179764836_1179764849 24 Left 1179764836 21:43564408-43564430 CCATGGCCTTGGGTAGCTCCACC 0: 7
1: 120
2: 603
3: 1174
4: 1697
Right 1179764849 21:43564455-43564477 CCTCTCCTGGCTGCTTTCATGGG 0: 28
1: 201
2: 627
3: 1035
4: 1310
1179764836_1179764850 28 Left 1179764836 21:43564408-43564430 CCATGGCCTTGGGTAGCTCCACC 0: 7
1: 120
2: 603
3: 1174
4: 1697
Right 1179764850 21:43564459-43564481 TCCTGGCTGCTTTCATGGGCTGG 0: 350
1: 579
2: 976
3: 1101
4: 1218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179764836 Original CRISPR GGTGGAGCTACCCAAGGCCA TGG (reversed) Intronic
Too many off-targets to display for this crispr