ID: 1179764837

View in Genome Browser
Species Human (GRCh38)
Location 21:43564414-43564436
Sequence CACAGGGGTGGAGCTACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2591
Summary {0: 10, 1: 228, 2: 487, 3: 783, 4: 1083}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179764837_1179764844 5 Left 1179764837 21:43564414-43564436 CCTTGGGTAGCTCCACCCCTGTG 0: 10
1: 228
2: 487
3: 783
4: 1083
Right 1179764844 21:43564442-43564464 GCAAGGTATAGCCCCTCTCCTGG 0: 3
1: 20
2: 97
3: 375
4: 903
1179764837_1179764852 30 Left 1179764837 21:43564414-43564436 CCTTGGGTAGCTCCACCCCTGTG 0: 10
1: 228
2: 487
3: 783
4: 1083
Right 1179764852 21:43564467-43564489 GCTTTCATGGGCTGGCATTGAGG 0: 14
1: 11
2: 25
3: 36
4: 194
1179764837_1179764849 18 Left 1179764837 21:43564414-43564436 CCTTGGGTAGCTCCACCCCTGTG 0: 10
1: 228
2: 487
3: 783
4: 1083
Right 1179764849 21:43564455-43564477 CCTCTCCTGGCTGCTTTCATGGG 0: 28
1: 201
2: 627
3: 1035
4: 1310
1179764837_1179764850 22 Left 1179764837 21:43564414-43564436 CCTTGGGTAGCTCCACCCCTGTG 0: 10
1: 228
2: 487
3: 783
4: 1083
Right 1179764850 21:43564459-43564481 TCCTGGCTGCTTTCATGGGCTGG 0: 350
1: 579
2: 976
3: 1101
4: 1218
1179764837_1179764847 17 Left 1179764837 21:43564414-43564436 CCTTGGGTAGCTCCACCCCTGTG 0: 10
1: 228
2: 487
3: 783
4: 1083
Right 1179764847 21:43564454-43564476 CCCTCTCCTGGCTGCTTTCATGG 0: 30
1: 166
2: 534
3: 723
4: 977

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179764837 Original CRISPR CACAGGGGTGGAGCTACCCA AGG (reversed) Intronic
Too many off-targets to display for this crispr