ID: 1179764839

View in Genome Browser
Species Human (GRCh38)
Location 21:43564425-43564447
Sequence TCCACCCCTGTGGCTTTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5397
Summary {0: 437, 1: 796, 2: 1347, 3: 1428, 4: 1389}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179764835_1179764839 -5 Left 1179764835 21:43564407-43564429 CCCATGGCCTTGGGTAGCTCCAC 0: 3
1: 136
2: 678
3: 1178
4: 1776
Right 1179764839 21:43564425-43564447 TCCACCCCTGTGGCTTTGCAAGG 0: 437
1: 796
2: 1347
3: 1428
4: 1389
1179764828_1179764839 24 Left 1179764828 21:43564378-43564400 CCAGGTCACGCTGATGTAAGAGG 0: 11
1: 270
2: 1256
3: 1510
4: 1207
Right 1179764839 21:43564425-43564447 TCCACCCCTGTGGCTTTGCAAGG 0: 437
1: 796
2: 1347
3: 1428
4: 1389
1179764836_1179764839 -6 Left 1179764836 21:43564408-43564430 CCATGGCCTTGGGTAGCTCCACC 0: 7
1: 120
2: 603
3: 1174
4: 1697
Right 1179764839 21:43564425-43564447 TCCACCCCTGTGGCTTTGCAAGG 0: 437
1: 796
2: 1347
3: 1428
4: 1389

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179764839 Original CRISPR TCCACCCCTGTGGCTTTGCA AGG Intronic
Too many off-targets to display for this crispr