ID: 1179764840

View in Genome Browser
Species Human (GRCh38)
Location 21:43564426-43564448
Sequence ACCTTGCAAAGCCACAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3085
Summary {0: 32, 1: 563, 2: 853, 3: 879, 4: 758}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179764840_1179764854 26 Left 1179764840 21:43564426-43564448 CCACCCCTGTGGCTTTGCAAGGT 0: 32
1: 563
2: 853
3: 879
4: 758
Right 1179764854 21:43564475-43564497 GGGCTGGCATTGAGGGTCTTCGG 0: 2
1: 10
2: 301
3: 690
4: 1123
1179764840_1179764844 -7 Left 1179764840 21:43564426-43564448 CCACCCCTGTGGCTTTGCAAGGT 0: 32
1: 563
2: 853
3: 879
4: 758
Right 1179764844 21:43564442-43564464 GCAAGGTATAGCCCCTCTCCTGG 0: 3
1: 20
2: 97
3: 375
4: 903
1179764840_1179764853 19 Left 1179764840 21:43564426-43564448 CCACCCCTGTGGCTTTGCAAGGT 0: 32
1: 563
2: 853
3: 879
4: 758
Right 1179764853 21:43564468-43564490 CTTTCATGGGCTGGCATTGAGGG 0: 15
1: 11
2: 25
3: 30
4: 154
1179764840_1179764850 10 Left 1179764840 21:43564426-43564448 CCACCCCTGTGGCTTTGCAAGGT 0: 32
1: 563
2: 853
3: 879
4: 758
Right 1179764850 21:43564459-43564481 TCCTGGCTGCTTTCATGGGCTGG 0: 350
1: 579
2: 976
3: 1101
4: 1218
1179764840_1179764852 18 Left 1179764840 21:43564426-43564448 CCACCCCTGTGGCTTTGCAAGGT 0: 32
1: 563
2: 853
3: 879
4: 758
Right 1179764852 21:43564467-43564489 GCTTTCATGGGCTGGCATTGAGG 0: 14
1: 11
2: 25
3: 36
4: 194
1179764840_1179764849 6 Left 1179764840 21:43564426-43564448 CCACCCCTGTGGCTTTGCAAGGT 0: 32
1: 563
2: 853
3: 879
4: 758
Right 1179764849 21:43564455-43564477 CCTCTCCTGGCTGCTTTCATGGG 0: 28
1: 201
2: 627
3: 1035
4: 1310
1179764840_1179764847 5 Left 1179764840 21:43564426-43564448 CCACCCCTGTGGCTTTGCAAGGT 0: 32
1: 563
2: 853
3: 879
4: 758
Right 1179764847 21:43564454-43564476 CCCTCTCCTGGCTGCTTTCATGG 0: 30
1: 166
2: 534
3: 723
4: 977

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179764840 Original CRISPR ACCTTGCAAAGCCACAGGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr