ID: 1179764842

View in Genome Browser
Species Human (GRCh38)
Location 21:43564430-43564452
Sequence CTATACCTTGCAAAGCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4516
Summary {0: 11, 1: 269, 2: 1293, 3: 1607, 4: 1336}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179764842_1179764854 22 Left 1179764842 21:43564430-43564452 CCCTGTGGCTTTGCAAGGTATAG 0: 11
1: 269
2: 1293
3: 1607
4: 1336
Right 1179764854 21:43564475-43564497 GGGCTGGCATTGAGGGTCTTCGG 0: 2
1: 10
2: 301
3: 690
4: 1123
1179764842_1179764852 14 Left 1179764842 21:43564430-43564452 CCCTGTGGCTTTGCAAGGTATAG 0: 11
1: 269
2: 1293
3: 1607
4: 1336
Right 1179764852 21:43564467-43564489 GCTTTCATGGGCTGGCATTGAGG 0: 14
1: 11
2: 25
3: 36
4: 194
1179764842_1179764853 15 Left 1179764842 21:43564430-43564452 CCCTGTGGCTTTGCAAGGTATAG 0: 11
1: 269
2: 1293
3: 1607
4: 1336
Right 1179764853 21:43564468-43564490 CTTTCATGGGCTGGCATTGAGGG 0: 15
1: 11
2: 25
3: 30
4: 154
1179764842_1179764847 1 Left 1179764842 21:43564430-43564452 CCCTGTGGCTTTGCAAGGTATAG 0: 11
1: 269
2: 1293
3: 1607
4: 1336
Right 1179764847 21:43564454-43564476 CCCTCTCCTGGCTGCTTTCATGG 0: 30
1: 166
2: 534
3: 723
4: 977
1179764842_1179764850 6 Left 1179764842 21:43564430-43564452 CCCTGTGGCTTTGCAAGGTATAG 0: 11
1: 269
2: 1293
3: 1607
4: 1336
Right 1179764850 21:43564459-43564481 TCCTGGCTGCTTTCATGGGCTGG 0: 350
1: 579
2: 976
3: 1101
4: 1218
1179764842_1179764849 2 Left 1179764842 21:43564430-43564452 CCCTGTGGCTTTGCAAGGTATAG 0: 11
1: 269
2: 1293
3: 1607
4: 1336
Right 1179764849 21:43564455-43564477 CCTCTCCTGGCTGCTTTCATGGG 0: 28
1: 201
2: 627
3: 1035
4: 1310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179764842 Original CRISPR CTATACCTTGCAAAGCCACA GGG (reversed) Intronic
Too many off-targets to display for this crispr