ID: 1179764844

View in Genome Browser
Species Human (GRCh38)
Location 21:43564442-43564464
Sequence GCAAGGTATAGCCCCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1398
Summary {0: 3, 1: 20, 2: 97, 3: 375, 4: 903}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179764841_1179764844 -10 Left 1179764841 21:43564429-43564451 CCCCTGTGGCTTTGCAAGGTATA 0: 11
1: 275
2: 1339
3: 1508
4: 1309
Right 1179764844 21:43564442-43564464 GCAAGGTATAGCCCCTCTCCTGG 0: 3
1: 20
2: 97
3: 375
4: 903
1179764835_1179764844 12 Left 1179764835 21:43564407-43564429 CCCATGGCCTTGGGTAGCTCCAC 0: 3
1: 136
2: 678
3: 1178
4: 1776
Right 1179764844 21:43564442-43564464 GCAAGGTATAGCCCCTCTCCTGG 0: 3
1: 20
2: 97
3: 375
4: 903
1179764840_1179764844 -7 Left 1179764840 21:43564426-43564448 CCACCCCTGTGGCTTTGCAAGGT 0: 32
1: 563
2: 853
3: 879
4: 758
Right 1179764844 21:43564442-43564464 GCAAGGTATAGCCCCTCTCCTGG 0: 3
1: 20
2: 97
3: 375
4: 903
1179764837_1179764844 5 Left 1179764837 21:43564414-43564436 CCTTGGGTAGCTCCACCCCTGTG 0: 10
1: 228
2: 487
3: 783
4: 1083
Right 1179764844 21:43564442-43564464 GCAAGGTATAGCCCCTCTCCTGG 0: 3
1: 20
2: 97
3: 375
4: 903
1179764836_1179764844 11 Left 1179764836 21:43564408-43564430 CCATGGCCTTGGGTAGCTCCACC 0: 7
1: 120
2: 603
3: 1174
4: 1697
Right 1179764844 21:43564442-43564464 GCAAGGTATAGCCCCTCTCCTGG 0: 3
1: 20
2: 97
3: 375
4: 903

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179764844 Original CRISPR GCAAGGTATAGCCCCTCTCC TGG Intronic
900264966 1:1752886-1752908 GCTAGGTCAAGCCCCTATCCAGG - Exonic
900730880 1:4258801-4258823 GCAGGGTACATCCCCTCTTCTGG - Intergenic
900815357 1:4839479-4839501 GCAGGGTATAGCCTCCCTCCTGG + Intergenic
900901490 1:5519513-5519535 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
900959366 1:5909425-5909447 GCCAGCTGTACCCCCTCTCCTGG - Intronic
901700956 1:11044609-11044631 GCGAGGCCTTGCCCCTCTCCGGG + Intronic
901885832 1:12222412-12222434 GCAGGGTACAGTCCCCCTCCTGG + Intergenic
902115382 1:14116777-14116799 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
902570645 1:17345034-17345056 GCAGGGTATAGCCTCCCTCCTGG - Intronic
903327850 1:22581531-22581553 GCAAGACATATCCCCTCTCTGGG - Intronic
903412955 1:23161691-23161713 GCCCTGTATAGCCCGTCTCCTGG - Intronic
904238404 1:29128504-29128526 GCAAGTCATTGCCCCTCTCTGGG - Intergenic
904386100 1:30143206-30143228 GCCAGGTACAGCCTCCCTCCTGG + Intergenic
904399254 1:30244962-30244984 CCAAGATGTTGCCCCTCTCCAGG - Intergenic
904576062 1:31505774-31505796 GCAAGCTGTGGCCCCTCTCTGGG + Intergenic
904928012 1:34063615-34063637 GCAGGGTATAGCCCCACTCTGGG + Intronic
906020842 1:42628052-42628074 GCAGGGTATAGCCTCCCTCCTGG - Intronic
906463836 1:46058490-46058512 GCAGGGTACAGCCTCCCTCCTGG - Intronic
906833569 1:49059662-49059684 GCAGGGTACAGTCCCCCTCCTGG - Intronic
907555956 1:55344386-55344408 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
907584842 1:55608070-55608092 GCAGGGTATAGCCCCACTTCTGG + Intergenic
907616709 1:55933823-55933845 GCAGGGTATAACCCCCCTCCTGG + Intergenic
907925716 1:58953580-58953602 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
908068556 1:60433935-60433957 GCAGGGTATAGCCTCCCTCCTGG + Intergenic
908699364 1:66881366-66881388 TCAGGGTATAGCCTCCCTCCTGG - Intronic
908715796 1:67068070-67068092 GCAGGTTATAGTCCCCCTCCTGG - Intergenic
909054272 1:70804144-70804166 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
909058007 1:70845412-70845434 GCAGGGTATAGACCCTCTTCTGG - Intergenic
909065521 1:70931261-70931283 GCAGGGTACAGCCCCCCTTCTGG + Intronic
909105240 1:71398330-71398352 GCAGGGTATAGCCCTCCTCCTGG - Exonic
909160887 1:72147945-72147967 GCAGGGTACAGCCTCCCTCCTGG + Intronic
909241641 1:73221458-73221480 GCAGGGTATAGCCCCACTCCTGG + Intergenic
909257266 1:73439468-73439490 GCAGGGTACAGCCTTTCTCCTGG - Intergenic
909293284 1:73912074-73912096 GTAGGGTAAAGCCCCCCTCCTGG + Intergenic
909371254 1:74885522-74885544 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
909373426 1:74913693-74913715 GCAGGGTATAGCCTCCCTCCTGG + Intergenic
909376819 1:74950688-74950710 GCAGGGTATAGTCCCTTTCCTGG - Intergenic
909632876 1:77785763-77785785 GCAGGGTACAGCCTCCCTCCCGG + Intronic
909751420 1:79165886-79165908 GCAGGGTACAGCACCCCTCCTGG - Intergenic
909757002 1:79239544-79239566 GCAGGGTACAGCCCCATTCCTGG + Intergenic
910055884 1:83032529-83032551 GCAGGGTATAGTCCCCCTCCTGG - Intergenic
910166829 1:84337080-84337102 GCAGGGTACAGCCTCCCTCCTGG + Intronic
910512848 1:88025551-88025573 GCAGGGTATAGACCCCCTCCTGG + Intergenic
910706853 1:90139526-90139548 GCAGGGTACAGCTCCTCTCCTGG + Intergenic
910708358 1:90153623-90153645 GCAGGATATAGCCCCCTTCCCGG + Intergenic
911135012 1:94429969-94429991 GCAGGGTACAGCCTCCCTCCTGG - Intronic
911267632 1:95762019-95762041 GCAGGGTATAGCTCCAGTCCTGG + Intergenic
911275041 1:95850170-95850192 GCAGGGTACAGCCTCTCTCCTGG - Intergenic
911407902 1:97464981-97465003 GCAGGGTATAGCCCTCCTCCTGG - Intronic
911465892 1:98251807-98251829 GCAGGGTACAGCCTCCCTCCAGG - Intergenic
911686214 1:100780442-100780464 CCAGGGTATAGCCCCCATCCTGG + Intergenic
911741033 1:101386988-101387010 GCAGGGTATAGCCCCTCTTCTGG + Intergenic
911790966 1:102014808-102014830 GCAGGGTACAGCTCCCCTCCTGG - Intergenic
911848387 1:102783615-102783637 GCAGGGTACAGCCGCCCTCCCGG + Intergenic
911855283 1:102868828-102868850 GCAGGGTACAGCTACTCTCCTGG + Intergenic
912043104 1:105416990-105417012 GCAGGGTATAGCCCTCCTCTTGG - Intergenic
912052018 1:105541616-105541638 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
912084550 1:105982393-105982415 GCAGGGTACAGCTCCCCTCCTGG - Intergenic
912223013 1:107699415-107699437 GCAGGGTACAGCCCCCCTCCTGG + Intronic
912405461 1:109434097-109434119 GCAGGGTACAGCCCTGCTCCTGG + Intergenic
912907029 1:113718335-113718357 GCAGGGTAAAGCCTCCCTCCTGG + Intronic
913101777 1:115574034-115574056 GCAGGTTATAGCCCCTCTCCTGG - Intergenic
913242123 1:116838248-116838270 GCAGGGTATAGCCCCCCTCCTGG - Intergenic
913344544 1:117795207-117795229 ACAAGCTATAGCCCCTGACCTGG - Intergenic
913459056 1:119064051-119064073 GCAGGGTACAGCCTCCCTCCTGG - Intronic
913709942 1:121472927-121472949 GCAAGGTATAGCCCCACTCCTGG + Intergenic
914523516 1:148439539-148439561 GCAGGGTGTAGCCCCCCTCCTGG - Intergenic
914988032 1:152476411-152476433 GCAGGGTACAGCCCCCCTTCAGG + Intergenic
915717054 1:157954646-157954668 GCAAGGGAGAGCCCCACTCTAGG + Intergenic
915811789 1:158920730-158920752 GAAGGGTACAGCCCCACTCCTGG - Intergenic
916296704 1:163227994-163228016 GCAAGGTACAGCCCTGCCCCAGG + Intronic
916411453 1:164550942-164550964 GCAGGGTATATCCCTGCTCCTGG + Intergenic
916688950 1:167172547-167172569 GCAGGGTACAGTCCCACTCCTGG - Intergenic
917140080 1:171826932-171826954 GCAGGGTACAGCCTCCCTCCAGG + Intergenic
917152073 1:171956506-171956528 GTAGGGTATAGCCCCCCTCCTGG + Intronic
917681782 1:177375138-177375160 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
918079541 1:181195171-181195193 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
918531107 1:185523805-185523827 GCAGGGTACAGCCTCTCTCCTGG + Intergenic
918969717 1:191398093-191398115 GCAGGGTATAGCCTCCCTCCTGG - Intergenic
919027873 1:192201267-192201289 GCAGAGTATAGCCCCCCTCCTGG + Intergenic
919124430 1:193378340-193378362 GCAGGGTACAGCCCCACCCCTGG - Intergenic
919242773 1:194936174-194936196 GCAGGGTATAGCCCCCTTCATGG - Intergenic
919409633 1:197227576-197227598 GCAGGGTATAGCCCCCCTCCTGG + Intergenic
920180105 1:204127229-204127251 GCCATGGACAGCCCCTCTCCAGG - Exonic
921466393 1:215492943-215492965 GCAGGGTACAGCCTCTCTCCTGG - Intergenic
921594292 1:217038018-217038040 GCAGGGTACAGCCTCCCTCCAGG + Intronic
921716073 1:218418185-218418207 GCAAGGTATAGCCCCCCTCTTGG - Intronic
921763224 1:218940864-218940886 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
921775723 1:219097382-219097404 GCAGGTTATAACCCCACTCCTGG - Intergenic
922530520 1:226341619-226341641 GCAGGGTATAGCCCCCCTCCTGG - Intergenic
922781500 1:228256543-228256565 GCAAGGGACAGACGCTCTCCAGG - Intronic
923233123 1:232007343-232007365 GCAGGGTACAGTCCCCCTCCTGG - Intronic
923687432 1:236163036-236163058 GCAGGGTACAGCCTCTCTCCCGG - Intronic
924036519 1:239943750-239943772 GCCAGGTAGAGCCCCACTCCTGG + Intergenic
924050873 1:240078531-240078553 GCAGGGTACAGCCTCCCTCCTGG - Intronic
924767462 1:247047077-247047099 GCAGGGTACAGCCCCATTCCTGG + Intronic
1063476694 10:6335064-6335086 ACCAGGTATTGCCCTTCTCCTGG + Intergenic
1065159842 10:22908510-22908532 GCAGGGTACAGCCCCTTTCCTGG + Intergenic
1066599932 10:37093623-37093645 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1067351591 10:45480974-45480996 GCAGGGTATAGCCCACCTCCTGG - Intronic
1067814756 10:49465097-49465119 GCAGGGTATAGCCCCCCTCCTGG - Intronic
1067911511 10:50351027-50351049 GCAGGGTACAGCCTCCCTCCCGG - Intronic
1068184255 10:53564531-53564553 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1068243607 10:54336901-54336923 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1068314567 10:55323446-55323468 ACAGGGTATAGCCCTCCTCCAGG - Intronic
1068399443 10:56509193-56509215 GCAGGGTATAGCCTCCCTCTTGG - Intergenic
1068431234 10:56934894-56934916 GCACGGTCCAGCCCCTCTCCTGG - Intergenic
1068452611 10:57211759-57211781 GCAGGGTATAGCCTTTCTCCTGG + Intergenic
1068454662 10:57238893-57238915 GCAGGATACAGCCCCCCTCCAGG - Intergenic
1068972454 10:62974222-62974244 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
1069070071 10:63983649-63983671 GCAAGGTACAGGCTCCCTCCTGG - Intergenic
1069173549 10:65262471-65262493 GCAGGGTATAGCCCCCGTTCTGG + Intergenic
1069424561 10:68278232-68278254 GCAGGGTATAGCCCCCCTTATGG - Intergenic
1069655238 10:70083066-70083088 ACAGGGTATAGCCCCCCTGCAGG + Intronic
1069875991 10:71563190-71563212 GCAAGGCACATCCCCTCTCTGGG + Intronic
1070309313 10:75261848-75261870 GCAAGGCATACCTCCTCTCTGGG + Intergenic
1070375966 10:75831467-75831489 GCAGGGTATAGCGCCGCTCCTGG + Intronic
1070456185 10:76619734-76619756 GCAGGGTACAGTCCCCCTCCTGG + Intergenic
1070870128 10:79744158-79744180 GCAGGGTACAGCCCCTCTCCTGG - Intergenic
1071395451 10:85218975-85218997 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1071637049 10:87266378-87266400 GCAGGGTACAGCCCCTCTCCTGG - Intergenic
1071658194 10:87471576-87471598 GCAGGCTACAGCCCCTCTCCTGG + Intergenic
1071873394 10:89818727-89818749 GCAGGTTATAGCCTCCCTCCTGG + Intergenic
1071942063 10:90601239-90601261 GCAGGCTACAGCCCCTATCCAGG - Intergenic
1071980970 10:91004109-91004131 GCAGGGTACAGCCCCGCTCCTGG + Intergenic
1072369077 10:94745288-94745310 GCAGGGTACAGCCCCACTCGTGG - Intronic
1072769327 10:98124589-98124611 GCAGGGTATAGCCCCACTCTTGG + Intergenic
1073708643 10:106015168-106015190 GCAGGGTATAGCCCTACTCCTGG + Intergenic
1073817507 10:107224051-107224073 GCAGGCTATAGCCACCCTCCTGG + Intergenic
1073841503 10:107503782-107503804 GCAGGTTGTAGCCCCACTCCTGG + Intergenic
1073883226 10:108007596-108007618 GCAAGGTACAGCCTCCCTCCCGG + Intergenic
1073994054 10:109295352-109295374 GCAGGGTACAGCCTCCCTCCAGG - Intergenic
1074025195 10:109626925-109626947 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1074041357 10:109793027-109793049 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
1074046409 10:109843631-109843653 GCAAGAAATAGCTCCTGTCCTGG + Intergenic
1074178229 10:111032604-111032626 GCAGGGTATAGCCTCCCTCCTGG + Intergenic
1074242190 10:111650410-111650432 GCAGAGTATAGACCCCCTCCTGG - Intergenic
1075530499 10:123225124-123225146 GCAGGGTACAGCCTCTCTCCCGG + Intergenic
1075826094 10:125358170-125358192 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1075937929 10:126359655-126359677 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1076492001 10:130868022-130868044 GCAAGGCAAAGCCCCCCTGCAGG + Intergenic
1077426162 11:2479113-2479135 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1077541661 11:3149363-3149385 GCAAGATCTTGCCCCTTTCCTGG - Intronic
1077827520 11:5826833-5826855 GCAGGGTGTAGGCCCCCTCCTGG - Intronic
1077984982 11:7342579-7342601 GCAGGGTACAGCCTCCCTCCCGG + Intronic
1078117308 11:8466557-8466579 GCAAGGTACAGCCTCCCTCCTGG + Intronic
1078201717 11:9189529-9189551 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1078301406 11:10134771-10134793 GCAGGGTATAGCCTCCCTCCTGG + Intronic
1078308883 11:10218911-10218933 GCAGGGTATAGCCCTGCTCCTGG + Intronic
1078379660 11:10828904-10828926 GCAGGGTATAGCCCCCGCCCTGG + Intronic
1078515018 11:12014539-12014561 GCGGGGCATAGCCCCCCTCCAGG - Intergenic
1078516102 11:12023699-12023721 GCAGGATATAGCCCCCCTCCTGG - Intergenic
1078687478 11:13546779-13546801 GTAGGGTATAGCCTCCCTCCCGG - Intergenic
1078834909 11:15017822-15017844 GCAGAGTATAGCCCACCTCCTGG - Intronic
1078959474 11:16248195-16248217 GCAAGGTAAAGCCCAACCCCTGG + Intronic
1079500205 11:21094316-21094338 GCAGGGTACAGCCTCCCTCCAGG + Intronic
1079521212 11:21328673-21328695 GCAGGGTATAGCTCCCCTCCTGG - Intronic
1079542687 11:21594493-21594515 GCAGGGTACAACCCCCCTCCTGG - Intergenic
1079586120 11:22128488-22128510 GCAGAGTATAGTCCCCCTCCTGG + Intergenic
1079721195 11:23816723-23816745 GCAGGGTACAGCACCTCTCCTGG + Intergenic
1079804370 11:24910918-24910940 GCAAGGTACAGCCCCCCTCCTGG - Intronic
1079838451 11:25365043-25365065 GCAGGGTACAGCCTCCCTCCCGG + Intergenic
1079886785 11:26000545-26000567 GCAGGGTACAGCCCCATTCCTGG + Intergenic
1080088568 11:28316181-28316203 GCAGGGTATAGCCCTGCTCCTGG - Intronic
1080359279 11:31493945-31493967 GCAGGGTACAGCTCCCCTCCTGG + Intronic
1080449692 11:32368670-32368692 GCAAGGTACAGCCTCCCTCCTGG + Intergenic
1080477402 11:32608501-32608523 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1080958582 11:37130671-37130693 CCACAGTATAGCCCCACTCCTGG - Intergenic
1080991753 11:37545361-37545383 ACAGGGTATGGCCTCTCTCCTGG + Intergenic
1081083791 11:38774754-38774776 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1081249642 11:40813970-40813992 GCAGGGTAGAGCCCTTCTCCTGG + Intronic
1081373582 11:42333693-42333715 GCAGGGTACAGCCCCACTCCTGG + Intergenic
1081400420 11:42636321-42636343 GCAGGGTACAGCCTCCCTCCGGG - Intergenic
1081598771 11:44477371-44477393 GCAGGGTACAGCCTCCCTCCCGG - Intergenic
1081939486 11:46928614-46928636 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1082652043 11:55805954-55805976 GCAGGGTATAGCACCCCTCCTGG + Intergenic
1082734226 11:56838607-56838629 ACAGGGTATAGCTCCCCTCCTGG + Intergenic
1082748455 11:56993746-56993768 GCAGGGTATATCCCCACTCCTGG + Intergenic
1083065197 11:59916681-59916703 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1083263812 11:61537039-61537061 GCAAGTCACAGCCCCTCTCTGGG - Intronic
1083500708 11:63105179-63105201 ACAGGGTACAGCCCCTCTACTGG + Intronic
1083506318 11:63160730-63160752 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1085158974 11:74323606-74323628 GCAAGAAATACACCCTCTCCTGG + Intergenic
1085194275 11:74658812-74658834 GCAGGGTACAGCCTCTCTCCTGG + Intronic
1085236556 11:75019953-75019975 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1085265952 11:75238245-75238267 GTAAGGCATTGCCCCTCTCTGGG - Intergenic
1085394391 11:76199930-76199952 GCAAACTATTGCCCCTCTCTGGG + Intronic
1085651585 11:78273302-78273324 GCAGGGTATAGCCTCTCTTCTGG - Intronic
1085861871 11:80244539-80244561 GCAGGGTACAACCCCACTCCTGG - Intergenic
1085875799 11:80404942-80404964 GCAGGGTACAGCCCCCTTCCTGG - Intergenic
1086503715 11:87479839-87479861 GCAGGGTACAGCTCCCCTCCTGG - Intergenic
1086580306 11:88391564-88391586 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1086605046 11:88686106-88686128 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1086750777 11:90490537-90490559 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1086764374 11:90676161-90676183 GCAAGGTACAGCCTCCCTCCTGG - Intergenic
1087255506 11:95948410-95948432 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1087438356 11:98151428-98151450 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1087541955 11:99532101-99532123 GCAGGGTATAGCCTCCCTTCTGG - Intronic
1087675680 11:101158538-101158560 CCAGAGTACAGCCCCTCTCCTGG - Intergenic
1088040470 11:105375420-105375442 GCAGGGTACAGCCCTCCTCCTGG + Intergenic
1088111543 11:106267341-106267363 GCAAGGTACAGCCTCCCTCCTGG - Intergenic
1088143639 11:106649034-106649056 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
1089115493 11:116091749-116091771 CCTAGGGATAGCCCCTCCCCAGG - Intergenic
1089797211 11:120990643-120990665 GCTAGGTAAATACCCTCTCCAGG - Intergenic
1091932141 12:4404533-4404555 GCAGGGTATAGCCTCCCTCCTGG - Intergenic
1092093556 12:5823571-5823593 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1092326332 12:7534959-7534981 GCAGGGTATAGCCTCCCTCCTGG - Intergenic
1092485758 12:8900958-8900980 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1092618135 12:10234260-10234282 GCAGGGTACAGCCCCACTCCTGG + Intergenic
1092652279 12:10647234-10647256 ACAGGGTATAGCCCCACTCCTGG - Intronic
1092662613 12:10755247-10755269 GCAGGGTATAGTCCCATTCCTGG + Intergenic
1093123344 12:15299659-15299681 TCAAGGTACAGCCCCACTCCTGG + Intronic
1093230503 12:16537324-16537346 GCAGGGTACAGCCCCTCTCCTGG + Intronic
1093297223 12:17405449-17405471 ACAGGGAATAGCCCCTCTCCTGG - Intergenic
1093590395 12:20895597-20895619 GCAGGGTATAGCCTCCCTCCTGG + Intronic
1093967211 12:25340413-25340435 GCAGGGTATAGCCCCTTTCCAGG + Intergenic
1094420310 12:30264016-30264038 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1094785729 12:33846489-33846511 GCAGGGTATAGCCTCCCTCCTGG + Intergenic
1094798413 12:34002198-34002220 GCAGGGTATAGCCTACCTCCTGG + Intergenic
1095235069 12:39785692-39785714 GCATGGTAGAGCCTCCCTCCTGG - Intronic
1095382867 12:41615884-41615906 GCAGGGTATAGCCCCTCTCCTGG - Intergenic
1095530554 12:43182041-43182063 GCAGTGTACAGCCCCTCTTCTGG + Intergenic
1096914165 12:55013770-55013792 GCAGGCTATAGCCCCCCTACTGG - Intergenic
1097368162 12:58742664-58742686 GCAGGGTACAGCCCTGCTCCTGG - Intronic
1097377911 12:58860532-58860554 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1097444031 12:59646752-59646774 GCATGGTACAGCCCCCCTCCTGG - Intronic
1097565699 12:61265643-61265665 GCAAGGTACAGCCTCCCTCCTGG - Intergenic
1097580740 12:61453796-61453818 GCAAGATACAGCCCTGCTCCTGG - Intergenic
1097609967 12:61807643-61807665 GCAAGGTACAGCCTCCTTCCTGG - Intronic
1097654633 12:62344452-62344474 GCAGGGTGTAGCCCCACTCCTGG + Intronic
1098163839 12:67673215-67673237 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1098493804 12:71112044-71112066 GCAGGGTACAGCCTCTTTCCAGG + Intronic
1098592269 12:72227970-72227992 GCAGGATATAGACCCCCTCCTGG + Intronic
1098628306 12:72699568-72699590 GCAGGGTATAGCACCCCTCCTGG + Intergenic
1098660490 12:73087477-73087499 GCAGGGTACAGCCTCTCTCCTGG + Intergenic
1098676398 12:73294691-73294713 GCAGGGTACAGCCTTTCTCCTGG - Intergenic
1098741520 12:74178929-74178951 GCAAGTTATAGCTCCCCTCTAGG + Intergenic
1098775930 12:74617610-74617632 CCAAGGTTAGGCCCCTCTCCAGG + Intergenic
1098778480 12:74653739-74653761 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1099008161 12:77260004-77260026 GTAGGGTATAGCCCCGCTCCTGG + Intergenic
1099076258 12:78113150-78113172 GCAGGGTACAGCCCCACTCCAGG + Intronic
1099096271 12:78378743-78378765 GCAGGGTATAGCCCCTTTCCTGG + Intergenic
1099105007 12:78486404-78486426 GCAGGGTATAGCCACCCTCCTGG + Intergenic
1099214653 12:79839029-79839051 GCAGGGTACAGCCCCACTCCTGG - Intronic
1099371421 12:81835429-81835451 GCAGGGTATAGCCTCCCTCTTGG - Intergenic
1099396563 12:82147411-82147433 GAAGGGTACAGCCTCTCTCCTGG - Intergenic
1099466993 12:83000552-83000574 GCAGGGTATAGCCCTCCTCTTGG + Intronic
1099507825 12:83500563-83500585 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1099655027 12:85478950-85478972 GCAGGCTAGAGCCTCTCTCCTGG + Intergenic
1099707913 12:86180509-86180531 ACAAGGTACAGCCTCCCTCCTGG - Intronic
1099722605 12:86383126-86383148 GCAGAGTATAACCCCTCTCCTGG - Intronic
1099780129 12:87183439-87183461 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1099846114 12:88030866-88030888 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1100086194 12:90913759-90913781 GAAGGGTACAGCCCCCCTCCTGG + Intronic
1100205544 12:92345367-92345389 GCAGGGTATAGCCTCCCTCCTGG - Intergenic
1100427643 12:94501989-94502011 GCAAGCTATAGCTCCTCTTCTGG + Intergenic
1100657919 12:96667141-96667163 GCAGGGTATGGCCTCCCTCCCGG + Intronic
1100674831 12:96855699-96855721 GCAGGGTATAGCCCCCCTCTTGG + Intronic
1100747437 12:97661468-97661490 GCAGGGTACAGCCCCCATCCTGG + Intergenic
1100929071 12:99585392-99585414 GCAGGGTACAGCCCCCCTCCCGG + Intronic
1101083813 12:101215044-101215066 GCAGGGTACAGCCTCTCTCTTGG - Intergenic
1101113310 12:101507091-101507113 GCAGGGTAGAGCCTCCCTCCAGG - Intergenic
1101663511 12:106788269-106788291 GCAGGGTATAGCTCCACACCTGG + Intronic
1101712542 12:107281949-107281971 GCAGGGTATAGCCCCCCTCCTGG + Intergenic
1102148769 12:110674060-110674082 GCAGGGTATAACCCACCTCCTGG - Intronic
1102528720 12:113530646-113530668 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1102751993 12:115302910-115302932 GCAAGGAATGGCTTCTCTCCTGG + Intergenic
1103210226 12:119160177-119160199 GCAAGGGAGTGCCCCTTTCCTGG + Exonic
1103880717 12:124163944-124163966 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1104342807 12:127967162-127967184 GCAGGGTATAGCTTCCCTCCTGG + Intergenic
1104588015 12:130062977-130062999 GCAAGGTATAGCCCCTCTCCTGG - Intergenic
1105764866 13:23549181-23549203 GCCAGGTAGAGACCCTCACCAGG - Intergenic
1105886837 13:24649708-24649730 GCAAGGTACAGCCACTCTGAGGG + Intergenic
1106262254 13:28078039-28078061 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1106589968 13:31090553-31090575 GCAGGGTAGAGCTCCTCCCCTGG - Intergenic
1106718831 13:32418663-32418685 GCAAGGTACAGCTCCACTCCTGG - Intronic
1106734852 13:32578326-32578348 TCAAGGTACAGCCCCCCTCCAGG - Intergenic
1106864485 13:33948623-33948645 GCAGGGTACAGCCCCTCTCCTGG - Intronic
1107188417 13:37550174-37550196 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1107554715 13:41507730-41507752 GCAGGGTACAGCCCCCATCCTGG + Intergenic
1108270645 13:48756240-48756262 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1108419529 13:50234210-50234232 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1108603756 13:52016968-52016990 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1108724275 13:53163457-53163479 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1108936732 13:55891184-55891206 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1109169232 13:59075462-59075484 GCAGGGTATAGCCTCCCTTCTGG + Intergenic
1109171972 13:59107933-59107955 GCAGGGTACAGGCCCCCTCCTGG - Intergenic
1109189487 13:59307833-59307855 GCAAGGTACAGCCCCGCTTCTGG + Intergenic
1109337220 13:61008377-61008399 GCAGGATACAGCCCCCCTCCTGG - Intergenic
1109346887 13:61125581-61125603 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1109390224 13:61682906-61682928 GCAAGGTACAGCCTCCTTCCTGG - Intergenic
1109475618 13:62876962-62876984 GCAGGATATAGCCCCCTTCCCGG + Intergenic
1109481787 13:62964702-62964724 TCAAGGTACAGCCCCACTCCTGG - Intergenic
1109614205 13:64809143-64809165 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1109810776 13:67509710-67509732 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1109862963 13:68224673-68224695 CCAGGGTATAGCTCCTCTTCTGG + Intergenic
1109883548 13:68512460-68512482 GCAGGGTACAGCCCCCTTCCTGG - Intergenic
1109905245 13:68831299-68831321 GCAGAGTACAGCCCCACTCCTGG - Intergenic
1110359708 13:74611075-74611097 GCAGGGTACAGGCCCCCTCCTGG - Intergenic
1110377917 13:74814829-74814851 GCAGGGTATAGCCTCCCTCCTGG - Intergenic
1110559718 13:76898097-76898119 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1111064543 13:83073052-83073074 GCAGGATACAGCCCTTCTCCTGG - Intergenic
1111083539 13:83343290-83343312 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1111154986 13:84310075-84310097 GCAGAGCATAGCCCCCCTCCTGG - Intergenic
1111336793 13:86836241-86836263 GCAGCATATAGCCCCCCTCCTGG + Intergenic
1111339317 13:86862883-86862905 GCAGGGTGCAGCCCCCCTCCTGG - Intergenic
1111372097 13:87332834-87332856 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1111421688 13:88019243-88019265 GCAGGGCAAAGCCCCCCTCCCGG - Intergenic
1111601575 13:90481566-90481588 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
1111687176 13:91516517-91516539 GCAGGGTACAGCCTCTCTCCTGG + Intronic
1111716599 13:91886839-91886861 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1111819361 13:93194360-93194382 GCAGGGTATAGCCCCCCTCCTGG - Intergenic
1112031302 13:95459152-95459174 GCAGGGTACAACCCCACTCCTGG + Intronic
1112259260 13:97863526-97863548 GCAAGGTACAGCCTCCCTCCTGG + Intergenic
1112364688 13:98746859-98746881 GGAAGGTCTAGTTCCTCTCCTGG - Intronic
1112623678 13:101078373-101078395 GCAGGGTACAGACCCCCTCCTGG - Intronic
1112789485 13:102987586-102987608 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1112812472 13:103234336-103234358 GCAAGGTACAGCCTCCCTCTTGG - Intergenic
1112857748 13:103792069-103792091 GCAGGGTATAGCCTCCCTCCCGG + Intergenic
1113029337 13:105976423-105976445 GCAGGGTATAGCCCCTCTCCTGG + Intergenic
1113166946 13:107453048-107453070 GCATGGTACAACCCCACTCCTGG + Intronic
1113212708 13:108001813-108001835 GCAGGGTATAGCCTCCCTCCTGG - Intergenic
1113512179 13:110865121-110865143 GTAAGGTACAGCCCCCCTCCTGG + Intergenic
1114171127 14:20273335-20273357 GCAGGGTAAAGCCCCCCTCCTGG - Intronic
1114706969 14:24737382-24737404 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1114871565 14:26665551-26665573 GCAGGGTATGGCCTCCCTCCCGG + Intergenic
1114986054 14:28230451-28230473 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1114989707 14:28272059-28272081 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1115007097 14:28498959-28498981 GCAAAGTATAGCCCCCCTCCTGG + Intergenic
1115010652 14:28540663-28540685 GCAGGGTACAGCCCCCCACCTGG - Intergenic
1115115942 14:29880698-29880720 GCAGGGTACAGCCTCTCTCCTGG - Intronic
1115132750 14:30073141-30073163 GCAGGGCGTAGGCCCTCTCCTGG - Intronic
1115298413 14:31856829-31856851 GCAGAGTATAGCCTCCCTCCCGG + Intronic
1115609004 14:35034194-35034216 GCAGGGAACAGCCCCCCTCCCGG + Intergenic
1116098851 14:40408122-40408144 GCAGGGTGCAGCCCCCCTCCTGG + Intergenic
1116133487 14:40890979-40891001 GCAGGGTATAGCCGCCCTCCTGG + Intergenic
1116239567 14:42323588-42323610 GGAAGGTATAGGCCTTCTACGGG + Intergenic
1116389569 14:44376726-44376748 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1116542304 14:46113112-46113134 GCAGGGTTAAGCCCCTCTCCTGG - Intergenic
1116642782 14:47486131-47486153 GCAGGGTATAGCCTCCCTCCTGG - Intronic
1116714114 14:48406742-48406764 GCAGGGTACAGCCCCACTCCTGG + Intergenic
1116854235 14:49937810-49937832 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1117085537 14:52196693-52196715 GCAGGGTACAGCCCTCCTCCTGG - Intergenic
1117632773 14:57710587-57710609 GCAGGGTACAGCCCCCATCCTGG - Intronic
1117762968 14:59051707-59051729 GCAAGGTATTTAACCTCTCCAGG + Intergenic
1117958899 14:61144091-61144113 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1118070945 14:62246046-62246068 GCAGGGTATAGTCCTACTCCTGG - Intergenic
1118151482 14:63195197-63195219 GCAGGGTATAACCTCACTCCTGG - Intergenic
1118365030 14:65087406-65087428 GCAAGGTACAGCCTCCTTCCTGG - Intronic
1118431848 14:65727084-65727106 GCAGTGTATAGCCCCCCTCCTGG + Intronic
1118533044 14:66728457-66728479 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1118657443 14:67967712-67967734 GCAGGGTATAGCTCCCCTCCTGG + Intronic
1118835913 14:69477804-69477826 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
1119007418 14:70944243-70944265 GCAGGGTACAGCTCCCCTCCTGG - Intronic
1119040436 14:71269701-71269723 GCAGGGTACAGCCCACCTCCTGG - Intergenic
1119198293 14:72733513-72733535 GCAAGCCATAGCTCCTGTCCTGG - Intronic
1119200606 14:72749131-72749153 GCAGAGTATAGCCTTTCTCCTGG - Intronic
1120082979 14:80236570-80236592 GCAGGGTATAGCCTTTATCCTGG + Intronic
1120104609 14:80480031-80480053 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1120392862 14:83930122-83930144 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1120765602 14:88324196-88324218 TCCAGGTTTAGCCCCTTTCCGGG - Intronic
1120799730 14:88675034-88675056 GCAGAGTATAGCCCCCTTCCTGG + Intronic
1120933745 14:89873823-89873845 GCAGGGTACAGCTCCCCTCCTGG + Intronic
1121063398 14:90938304-90938326 GCAGGGTACAGTCCCCCTCCTGG + Intronic
1121128886 14:91427551-91427573 GCAGGGTACAGCCCCACTCCTGG - Intergenic
1121483779 14:94298072-94298094 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1121611578 14:95284512-95284534 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1121744734 14:96279329-96279351 GCAAAGAATTTCCCCTCTCCGGG + Intergenic
1122401582 14:101470462-101470484 GCAGGGTAGAGCCCCTCCCCCGG + Intergenic
1123138296 14:106050770-106050792 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1123197389 14:106629614-106629636 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1123198728 14:106641490-106641512 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1123449533 15:20351254-20351276 GCAAGGTCTAGGCTCACTCCAGG + Intergenic
1123696803 15:22884546-22884568 GCAGGGTACAGTCCCCCTCCTGG + Intronic
1123737505 15:23199857-23199879 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1123795663 15:23767462-23767484 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1124001154 15:25761519-25761541 GCTGGGTACAGCCCCACTCCTGG - Intronic
1124288718 15:28428520-28428542 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1124294507 15:28488794-28488816 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1124556029 15:30726817-30726839 GCAGGGTATAGACCCACTCCTGG + Intronic
1124675245 15:31678954-31678976 GCAGGGTATAGACCCGCTCCTGG - Intronic
1124695772 15:31863166-31863188 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1125273927 15:37970895-37970917 GCAGGATATAGCCCCCCTCCTGG + Intergenic
1125279333 15:38027212-38027234 GCAGGGTATAGCCTCCCTCCTGG - Intergenic
1125472051 15:40014202-40014224 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1126126449 15:45298443-45298465 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1126185030 15:45823473-45823495 GCAGGGTATAGCCCCCCTCCTGG + Intergenic
1126366817 15:47903073-47903095 GCAGGGTAAAGCCCCACTCCTGG + Intergenic
1126399772 15:48257228-48257250 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1126515059 15:49524696-49524718 GCAGGGTATATCCCTCCTCCAGG - Intronic
1126533207 15:49732984-49733006 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
1127955258 15:63847529-63847551 GCAGGGTATAGCTCCCCTCCTGG - Intergenic
1128693324 15:69742289-69742311 GCAAGGAAGTGCCCCTCTCTGGG - Intergenic
1129549272 15:76430421-76430443 GTAGGGTATAGCCCCTCTCTTGG - Intronic
1129900989 15:79149424-79149446 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
1130210716 15:81919181-81919203 GCAAGGTACAGCCCCCATCCTGG - Intergenic
1130421981 15:83757004-83757026 GCAGGGTATAGCCCCTCTCCTGG + Intronic
1130894814 15:88161742-88161764 GCATCCTAGAGCCCCTCTCCAGG + Intronic
1131432594 15:92398701-92398723 GCAGGGTATACAACCTCTCCAGG - Intronic
1131659574 15:94499217-94499239 GCAGGGTACAGCCCACCTCCTGG - Intergenic
1131724609 15:95207626-95207648 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1131980236 15:97987453-97987475 ACAGGGTATAGCCTCTCTCCTGG - Intergenic
1134658124 16:15963266-15963288 GCAGGGTATAGCCCCGCTCCTGG + Intronic
1135925972 16:26694524-26694546 GCAAGGTACAGCCTCCCTCCTGG + Intergenic
1136674734 16:31892826-31892848 GCAGGGTATAGCCACCCTCCTGG + Intronic
1137951985 16:52792233-52792255 GCAGGGTACAGCCCCACTCCTGG - Intergenic
1138355854 16:56379854-56379876 GCAGGGTACAGCCTCCCTCCCGG + Intronic
1138805549 16:60085324-60085346 GCAGGGTACAGCCTCCCTCCCGG + Intergenic
1139033261 16:62911413-62911435 GCAGGGTACAGCCCCCCTTCAGG + Intergenic
1140776832 16:78256533-78256555 GCAATGTAATGACCCTCTCCTGG + Intronic
1141037762 16:80643318-80643340 GCAGGGTTCAGCCTCTCTCCTGG + Intronic
1141097301 16:81171920-81171942 GCAAGGAATGGCTTCTCTCCTGG + Intergenic
1141273108 16:82558597-82558619 GCAGGGTGTAGCCCCCCTCCTGG - Intergenic
1141313033 16:82933921-82933943 GCAGGGTACAGCCCTCCTCCTGG + Intronic
1141317879 16:82978942-82978964 GCAGGGTACAACCCCCCTCCCGG - Intronic
1141462420 16:84185435-84185457 GCAAGGGGCAGCCTCTCTCCCGG + Intronic
1141546967 16:84776683-84776705 GCTAGGGATTGCTCCTCTCCTGG + Intronic
1144285413 17:13769761-13769783 GCAGGGTACAGCCCCCCTCTAGG + Intergenic
1144944042 17:18960775-18960797 GCAAGTCATTGCCCCTCTCTGGG - Intronic
1145262740 17:21364585-21364607 GCAAGCAGCAGCCCCTCTCCTGG + Intergenic
1145356998 17:22168074-22168096 GCAGGGTACAGCCCCACTTCTGG + Intergenic
1145378124 17:22370674-22370696 GCAGGGTATAACCCACCTCCTGG + Intergenic
1146697430 17:34920274-34920296 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1147886681 17:43688934-43688956 GCAAGGCCTATCCCCTCTCTGGG + Intergenic
1148024977 17:44580741-44580763 GCAAGTTATGTCCCCTCTCCTGG + Intergenic
1148640806 17:49185767-49185789 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1149052652 17:52325341-52325363 GCAGGGTATAGCCCCCATCCTGG + Intergenic
1149072255 17:52556799-52556821 GCAGGGTACAGCCCCTCTCCTGG - Intergenic
1149112320 17:53048482-53048504 GCAGGGTACAGCCCCGCTACTGG + Intergenic
1149135598 17:53359814-53359836 GTAAGGTACAGCCCCCCTCTCGG - Intergenic
1149216153 17:54357236-54357258 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1149260765 17:54877396-54877418 GCAGGATACAGCCTCTCTCCTGG - Intergenic
1149341160 17:55687707-55687729 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1149896563 17:60432994-60433016 GCAGGATACAGCCCCACTCCTGG + Intergenic
1150687439 17:67331961-67331983 GCAGGGTATAGCCCCCCTCCTGG - Intergenic
1150830839 17:68518112-68518134 GCAGGGTACAGCCCCCCTCCTGG + Intronic
1151135886 17:71945396-71945418 GCAGGGTACAGTCCCCCTCCCGG - Intergenic
1151381004 17:73725812-73725834 GCTAGGTCTTGCCCCTGTCCAGG - Intergenic
1151905457 17:77045567-77045589 GGAAGGTACTGCCCCTTTCCTGG + Intergenic
1152805039 17:82351701-82351723 CCCAGGTATAGCCCCTGGCCCGG + Intergenic
1153076240 18:1165029-1165051 GTAGAGTATAGTCCCTCTCCTGG + Intergenic
1153262948 18:3241772-3241794 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1153454970 18:5271041-5271063 GCAGGGTATAGCTCCCCTCTTGG + Intergenic
1153539018 18:6134743-6134765 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1155171587 18:23270595-23270617 GCAGGGTATAGTTCCCCTCCTGG - Intronic
1156169308 18:34463139-34463161 GCAGGGAACAGCCCCACTCCTGG + Intergenic
1156243647 18:35276932-35276954 GCAGGGTACAGCACCCCTCCTGG - Intronic
1156265855 18:35488081-35488103 GCAGGGTATAGCCTCCCTCCTGG + Intronic
1156711968 18:39958017-39958039 GCAGGGTATAGCCCCGCTCCTGG - Intergenic
1157506487 18:48230245-48230267 GCAAGGTTTATCCCCTGTTCAGG + Intronic
1158421747 18:57301036-57301058 GAAAGGTTTAGCCCCTGCCCAGG + Intergenic
1158786660 18:60721311-60721333 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1158822693 18:61179264-61179286 GCAAGGTACAGCCCCACTCCTGG - Intergenic
1159157286 18:64601203-64601225 GCAGAGCATAGCCCCCCTCCTGG + Intergenic
1159180225 18:64893166-64893188 GCAGGGTATAGCCCCACTCCTGG + Intergenic
1159196503 18:65122740-65122762 GCAGGGTACAGCCCCTCTCCTGG - Intergenic
1159204610 18:65233407-65233429 GCAGGGCACAGCCCCACTCCTGG - Intergenic
1159357824 18:67359154-67359176 GCAGGGTAGAGCCCCGCCCCTGG - Intergenic
1159652631 18:70996009-70996031 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1159896041 18:73996837-73996859 GCAGGGTACAGCCCCCCTCCTGG - Intergenic
1159962358 18:74565688-74565710 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1159996569 18:74970662-74970684 GCAGGGTATAGCCCCCCTCCTGG + Intronic
1160082083 18:75737326-75737348 GCAGGGTTTAGACCCTCTCCTGG - Intergenic
1160244137 18:77143691-77143713 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1160258202 18:77265391-77265413 GCAGGGCATAGCCCCCTTCCGGG + Intronic
1160601294 18:80014579-80014601 GCAGGGTACAGCCTCCCTCCAGG + Intronic
1161271643 19:3392862-3392884 GCAATGCCTCGCCCCTCTCCGGG - Intronic
1163466324 19:17470328-17470350 GCCAGGCATCGCCCCTTTCCAGG - Intronic
1163663767 19:18593699-18593721 GCAGGGTCCTGCCCCTCTCCGGG + Intronic
1164214174 19:23129340-23129362 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1164414031 19:28031336-28031358 GCAGGGCATAGTTCCTCTCCTGG + Intergenic
1164851110 19:31485062-31485084 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1165095418 19:33407286-33407308 GCAAGGGATGGTCCCTCTCTGGG + Intronic
1165888338 19:39095514-39095536 GCAGGGTATAGCCTCCCTCCTGG + Intronic
1165974732 19:39665817-39665839 GCAGGGTATAGCCCACCTCCTGG + Intergenic
1166164896 19:40980538-40980560 GCAGAGTACAGCCCCGCTCCTGG + Intergenic
1166252687 19:41582281-41582303 GCAGGGTACAGCCCCACTCCTGG + Intronic
1166410092 19:42550892-42550914 GCAAGATACAGCCTCCCTCCTGG - Intronic
1166526457 19:43513392-43513414 GCAGGGTACAGCCCCACTCCTGG - Intronic
1167873055 19:52389557-52389579 GCAGGGTACAGCTCCTCTCCTGG + Intergenic
1168501659 19:56898251-56898273 GACAGATAAAGCCCCTCTCCTGG - Intergenic
925456012 2:4017281-4017303 GCTTGGTACAGCCCCACTCCTGG + Intergenic
925473964 2:4192361-4192383 GCAGGGTATAACCCCCATCCTGG + Intergenic
925499022 2:4483736-4483758 GCAGGATATAGCCCCTCTCCTGG - Intergenic
925526961 2:4813819-4813841 GCAGGGGATAGCCCCCCTCCTGG + Intergenic
925596250 2:5558339-5558361 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
925805583 2:7644841-7644863 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
926483911 2:13432127-13432149 GCAGGGTATAGCCCCACTCTTGG + Intergenic
926502431 2:13673044-13673066 CTAGGGTATAGCCTCTCTCCTGG + Intergenic
926791360 2:16575020-16575042 GCAGGGTATAGCACCCTTCCTGG - Intronic
926869003 2:17391769-17391791 GCAGGGTATAACCCCCCTCTGGG - Intergenic
926929556 2:18023510-18023532 GCAGGGTAGAGCCCCCTTCCTGG + Intronic
926938992 2:18115421-18115443 GCAGGGTGCAGCCCCCCTCCTGG - Intronic
926952187 2:18254471-18254493 GCAGGGTACAGCCTCCCTCCTGG - Intronic
927126986 2:20021112-20021134 GCAGGGTACAGCCCCCCTCTTGG + Intergenic
927242102 2:20928330-20928352 GCAGGATACAGCCCCCCTCCTGG + Intergenic
927340916 2:21982436-21982458 GCAGGGTATAGCCCCCGTCCTGG + Intergenic
927401832 2:22720985-22721007 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
927409223 2:22805898-22805920 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
927438167 2:23088384-23088406 GCAGGGCATAGCCTCCCTCCTGG + Intergenic
927605680 2:24484235-24484257 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
928474652 2:31614446-31614468 GCAGGGTACAGCTCCTCTCCTGG + Intergenic
928594331 2:32845853-32845875 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
928725736 2:34171692-34171714 GCAGGGTACAGCTCCCCTCCTGG + Intergenic
928821489 2:35366762-35366784 GCAGGTTATAGCCCCCCTCCTGG - Intergenic
928853895 2:35781633-35781655 GCAGGGTATAGCCTCCCTCCTGG - Intergenic
929211206 2:39359393-39359415 GCAGGGTACAGCTCCCCTCCTGG + Intronic
929382459 2:41368777-41368799 GCAAGGTACAGCTCCTCTCCTGG + Intergenic
929872123 2:45768001-45768023 CCAAGGAATAGCTCCTCTCCAGG - Intronic
930238930 2:48915907-48915929 GCAGGGCATAGACCCTCTGCAGG + Intergenic
930310319 2:49731969-49731991 GCAGGGTATACCCTCCCTCCTGG + Intergenic
930521363 2:52471156-52471178 GCAGGGTATAGCTCCCCTCCTGG - Intergenic
930585552 2:53263395-53263417 GCAGGGTAAAGCCCCCGTCCTGG + Intergenic
930960093 2:57251198-57251220 GCAAGGTACAGTCCTACTCCTGG + Intergenic
931006554 2:57856131-57856153 GCAGGGTACAGTCCCACTCCCGG + Intergenic
931272182 2:60712841-60712863 TGCAGGTATAGCCCCTCTCCTGG - Intergenic
931494056 2:62783217-62783239 GCAGGGTACAGCCCCCCTCCTGG + Intronic
931949781 2:67349831-67349853 GCAGGATACAGCCCCACTCCTGG + Intergenic
932537664 2:72617193-72617215 GCAGGGTATAGCCCCCCTCCTGG + Intronic
932849587 2:75171605-75171627 GCAGGGTACAGTCCCCCTCCTGG - Intronic
932904354 2:75733593-75733615 GCAGGGTACAGCCTCCCTCCCGG + Intergenic
932912224 2:75818060-75818082 GCAGGGTATAGCCCCGCTCCTGG + Intergenic
932915751 2:75856155-75856177 GCAGAGTATAGCCCCACTTCTGG - Intergenic
933064124 2:77772780-77772802 GCAGGGTACAGCCTCCCTCCCGG + Intergenic
933418726 2:82022074-82022096 GCAAGGGACAGCCTCCCTCCCGG + Intergenic
933548097 2:83740389-83740411 GCAGGGAATAGCCCCCCTCTAGG + Intergenic
933798652 2:85942259-85942281 GCAGGGTACAGCCCTTCTCCTGG + Intergenic
933947145 2:87296624-87296646 GCAAGGTACAGCCTCCCTCCAGG + Intergenic
934011971 2:87830229-87830251 GCAGGGTACAGGCTCTCTCCTGG + Intergenic
934017132 2:87899694-87899716 GCAGGATACAGCCCCCCTCCTGG - Intergenic
934113065 2:88760018-88760040 GCAGGGTATAGCCCCCATCCTGG - Intergenic
934610519 2:95732092-95732114 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
934940431 2:98497507-98497529 GCAGGGTATAGTCCCCCTCCTGG - Intronic
935724112 2:106008020-106008042 GCATGGTACAGCCTCCCTCCAGG - Intergenic
935927829 2:108089416-108089438 GCAGGGTACAGCTTCTCTCCTGG - Intergenic
935949016 2:108312148-108312170 GCAGGGTACAGCCTCCCTCCAGG - Intergenic
936096781 2:109536266-109536288 GCAAGGTATATCCTCCCTCGTGG - Intergenic
936169430 2:110155517-110155539 GCAGGGTATAACCCCACTCCTGG - Intronic
936333044 2:111564944-111564966 GCAAGGTACAGCCTCCCTTCAGG - Intergenic
936549837 2:113427605-113427627 GCAGGGTACAGCCTCTCTCCAGG - Intergenic
936843473 2:116802381-116802403 GCAGGGTATAGCCCCTCTCCTGG + Intergenic
936862321 2:117032575-117032597 GCAGGGTATAGCACCCCTCGTGG + Intergenic
936872081 2:117145690-117145712 GCAGGGTACTGCCCCCCTCCTGG + Intergenic
936994484 2:118398795-118398817 GCAGAGTATAGCCCTACTCCTGG - Intergenic
937008965 2:118544440-118544462 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
937427708 2:121813769-121813791 GCAGGGTATATCCCCCCTCCCGG - Intergenic
937547092 2:123036044-123036066 GCAGGGTTTAGCCCCCCTTCTGG + Intergenic
937554097 2:123132639-123132661 GCAGGGTAAAGCCCCTTTCCTGG - Intergenic
937800664 2:126077248-126077270 GCAAGGTACAGCCCAACTCCTGG - Intergenic
937881220 2:126866288-126866310 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
938165430 2:129021594-129021616 GCAAGGTATAGCCCCCCTCCTGG - Intergenic
938686328 2:133741912-133741934 GCAGGGTAAAGCCTCCCTCCTGG + Intergenic
938868804 2:135452770-135452792 GCAGGGTAGAGCCTCCCTCCTGG + Intronic
939053308 2:137332179-137332201 GCAGGGTACAGCCCTCCTCCTGG - Intronic
939225067 2:139354155-139354177 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
939287647 2:140153959-140153981 GCAGGGTACAGCCTCACTCCCGG + Intergenic
940355589 2:152738238-152738260 GCAGGGTACAGCCTCCCTCCTGG + Intronic
940408841 2:153336350-153336372 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
940502003 2:154504783-154504805 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
940687721 2:156874835-156874857 TCAAGGCATAGCCTCTATCCTGG - Intergenic
940691389 2:156924445-156924467 TGAGGGTACAGCCCCTCTCCTGG - Intergenic
940825667 2:158409323-158409345 GTAGGATATAGACCCTCTCCTGG - Intronic
941137316 2:161733772-161733794 GCAGGGTACAGCCTCCCTCCTGG - Intronic
941142755 2:161805733-161805755 GCAGGATATAGCCCACCTCCTGG + Intronic
941307718 2:163892010-163892032 GCAGGGTGTAGCCCCCATCCTGG + Intergenic
941319852 2:164041160-164041182 GCAGGGTACTGCCTCTCTCCTGG + Intergenic
941445271 2:165592042-165592064 GCAGGGTACAGCTCCCCTCCTGG - Intronic
941477630 2:165968389-165968411 GCAGGGTACAGCCTCCCTCCCGG - Intergenic
941560339 2:167036310-167036332 GCAGGGTACAGCCTCCCTCCTGG - Intronic
941803545 2:169687630-169687652 GCAGGGTACAGCCTCCCTCCTGG + Intronic
941977789 2:171424436-171424458 GCAGGGTACAGCCCCTGTCCTGG - Intronic
942234375 2:173889878-173889900 GCAAGGTACAGCCCCACACCTGG - Intergenic
942281058 2:174364319-174364341 GCAAGGTATAGCCTCCCTCCTGG + Intronic
942283435 2:174390192-174390214 GCAGGGTATAACCCCTCTCCTGG - Intronic
942644448 2:178095461-178095483 GCAGGGTACAGCCCTGCTCCTGG + Intronic
942880669 2:180857441-180857463 GCAGGGTACATCCCCCCTCCAGG + Intergenic
943006504 2:182392890-182392912 GCAGGGTACAGCCTCCCTCCTGG + Intronic
943072141 2:183153658-183153680 GCAGGGTACAGCCTCCCTCCTGG + Intronic
943092987 2:183396035-183396057 TCAGGGTATAGACCCCCTCCTGG - Intergenic
943107886 2:183570138-183570160 GAAAGGTATAGTCCTTCTACAGG + Intergenic
943193910 2:184718760-184718782 GCAAGGTATAGCCTCCCTCCTGG + Intronic
943223465 2:185139768-185139790 GCAGGGTACAGCCCCACTCCTGG + Intergenic
943245939 2:185451057-185451079 GCAGGGTATAGTCTCCCTCCTGG + Intergenic
943372159 2:187028625-187028647 GCAGGGTACATCCCCCCTCCTGG - Intergenic
943406312 2:187492540-187492562 GCAGGGTACAGCCTCCCTCCTGG - Intronic
943437623 2:187885988-187886010 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
943478135 2:188384925-188384947 GCAGGGTATAGCTGCCCTCCTGG + Intronic
943511298 2:188830647-188830669 GCAGGGTATAACCCCCCTCCTGG - Intergenic
944106435 2:196083996-196084018 GCAGGGTAAAGCCCCACTCCTGG - Intergenic
944250259 2:197574223-197574245 GCAGGGTACAGCCCCCCTCCTGG - Intronic
944458132 2:199916776-199916798 GCAGGGTACAGCCCCCCTCCAGG + Intronic
944477724 2:200124673-200124695 GCAGGGTATGGCCCTCCTCCTGG + Intergenic
944827944 2:203504012-203504034 GCAGGGTACAGCCTCCCTCCTGG + Intronic
945073728 2:206016154-206016176 GCAGGGTATAGCCCCTCTCCTGG - Intronic
945114108 2:206394029-206394051 GCAGGGTACAGCCCCACTCCTGG - Intergenic
945166599 2:206953543-206953565 GCAAGGTATAGCCCCACTCCTGG + Intronic
945457143 2:210063511-210063533 GCAGAGTATAGCCCCCTTCCTGG - Intronic
945760001 2:213903062-213903084 GCAGGGTACAGCCTCCCTCCTGG + Intronic
946760536 2:222989126-222989148 GCAGGGTATAGCCTCCCTCTTGG + Intergenic
947008393 2:225538084-225538106 GCATGGTACAGCCTCCCTCCTGG + Intronic
947248611 2:228077382-228077404 GCCAGGTACAGCCTCCCTCCTGG - Intronic
948016697 2:234697034-234697056 ACAGGGTACAGCCCCTCTCCTGG + Intergenic
948070057 2:235113878-235113900 GCAGGGCAAAGCCCCTCTGCTGG - Intergenic
1169676294 20:8158906-8158928 GCAGGGTACAGCCCCCTTCCTGG + Intronic
1170310122 20:14982975-14982997 GCAGGGTACAGCCTCCCTCCCGG - Intronic
1170643821 20:18179161-18179183 GCAGGGTATAGCCCCCCTCCTGG + Intronic
1170875229 20:20244084-20244106 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1171534338 20:25872986-25873008 GCAGGGTATAGCCCACCTCGTGG - Intergenic
1171571531 20:26255869-26255891 GCAGGGTATAGCCCACCTCCTGG - Intergenic
1171792798 20:29543855-29543877 GCAGGGTATAGCCCACCTCCTGG + Intergenic
1171855668 20:30340549-30340571 GCAGGGTATAGCCCACCTCCTGG - Intergenic
1172882230 20:38209429-38209451 GCAAGTCATTGCCCCTCTCCAGG + Intergenic
1173023587 20:39287709-39287731 GCAGGGTACAGCCTCTCTTCTGG - Intergenic
1173412805 20:42829058-42829080 GCATGGTATAGCCCCCCTTCTGG - Intronic
1173711094 20:45156264-45156286 GCAGGGTACAGCCCCCCTCCAGG - Intergenic
1174087812 20:48021516-48021538 GCCAGACAGAGCCCCTCTCCAGG - Intergenic
1174951090 20:55041981-55042003 GCAGGGTACAGCCTCCCTCCCGG - Intergenic
1175011742 20:55744697-55744719 GCAAGGCATAGCCCATCTCTGGG - Intergenic
1175044698 20:56093974-56093996 TCGGGGTACAGCCCCTCTCCTGG + Intergenic
1175214908 20:57387039-57387061 GAAAGGTTCAGCCCCTCTCCAGG - Intergenic
1175267553 20:57711619-57711641 GCTGGGTATTGCCCCACTCCTGG - Intergenic
1176358674 21:5974108-5974130 GCAAGGTATAGCCCCTCTCCTGG - Intergenic
1177017976 21:15815481-15815503 GCAAGGTACAGCCTCCCTCCTGG - Intronic
1177067996 21:16464354-16464376 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1177068150 21:16465557-16465579 ACATGGCACAGCCCCTCTCCAGG - Intergenic
1177197564 21:17919065-17919087 GCAGGGTAAAGTCCCGCTCCTGG + Intronic
1177259639 21:18712985-18713007 GCAGGGTATAGCCCAGCTCCTGG - Intergenic
1177288221 21:19078194-19078216 GCAAGGTACAGCCTCCCTCCTGG - Intergenic
1177359590 21:20050402-20050424 GCAGGGTACAAACCCTCTCCTGG - Intergenic
1177471229 21:21563464-21563486 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1177554569 21:22672583-22672605 GCAAGGTACAGCCTCTCTCCTGG - Intergenic
1177577377 21:22975976-22975998 TGAAGGTATAGCTCCCCTCCTGG + Intergenic
1177628826 21:23700683-23700705 GCAGGGTACAGCCCCTGTTCTGG - Intergenic
1177854261 21:26383831-26383853 GCAAGGTACAACCCCCATCCTGG - Intergenic
1177918681 21:27123800-27123822 GGAGGGTATAGCCCTTTTCCTGG + Intergenic
1178046134 21:28696500-28696522 GCAGGGTATAGCCCCTCTCCTGG + Intergenic
1178221884 21:30669497-30669519 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1178634171 21:34288006-34288028 GCAGGGTACAGCTCCCCTCCTGG + Intergenic
1179235256 21:39540104-39540126 GCAGGCTATAGCCTCCCTCCTGG + Intergenic
1179332123 21:40413353-40413375 GCAGGGTATAGCCTCCCTCCTGG - Intronic
1179450235 21:41463557-41463579 GCAAGGTATAGCTTCCTTCCTGG - Intergenic
1179764844 21:43564442-43564464 GCAAGGTATAGCCCCTCTCCTGG + Intronic
1179936733 21:44610762-44610784 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1180152897 21:45961115-45961137 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1180251446 21:46592753-46592775 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1180406605 22:12561349-12561371 GCAGGGTACAGCCCTCCTCCTGG + Intergenic
1180573716 22:16752886-16752908 GCAGGGTATAGCCCACCTCCTGG - Intergenic
1181746790 22:24960818-24960840 GAAAGGTATAGCCACTCTGCTGG - Intronic
1182297040 22:29315838-29315860 GGAAGGGGTAGGCCCTCTCCGGG - Intronic
1182887719 22:33789581-33789603 GCAGGGTACAGCCCCCATCCTGG - Intronic
1183004555 22:34890325-34890347 GCAGGGTACAGCCCCACTCCTGG - Intergenic
1183163472 22:36130439-36130461 TGAAGGAATTGCCCCTCTCCAGG - Intergenic
1184507282 22:44911914-44911936 GCAGGGTATAGCCTCCCTCCTGG - Intronic
1184713206 22:46265277-46265299 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
949292505 3:2483086-2483108 GCAGGGTATAGCACCCCTCCTGG - Intronic
949464353 3:4329102-4329124 GCAGGGTACAGCCCTTCTCCTGG + Intronic
949623567 3:5844180-5844202 GCAGAGTACAGCCCCTCTCCTGG + Intergenic
949635916 3:5981408-5981430 GCAGGGTATATCCCCCCTCCTGG + Intergenic
949768414 3:7552280-7552302 GTAGGGTACAGCCCCACTCCTGG + Intronic
950146067 3:10650820-10650842 GCAGGGCATAGCTCCCCTCCTGG - Intronic
950178984 3:10897645-10897667 GCAGGGTACAGCCTCCCTCCTGG + Intronic
950468554 3:13170554-13170576 GCAGGGTACAGCCTCCCTCCCGG - Intergenic
950680939 3:14584662-14584684 GCAAGTTATGGCCCCTCTCTGGG - Intergenic
950700637 3:14743416-14743438 GCAGGGTACAGCCTCCCTCCTGG + Intronic
950913259 3:16616731-16616753 GCAGGGTACAACCCCTCTCCTGG - Intronic
950963409 3:17129023-17129045 TCAGGGTATAGCCCCACTCCTGG - Intergenic
950990615 3:17434053-17434075 GCAGGGTACAGCTCCCCTCCCGG + Intronic
951093030 3:18597705-18597727 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
951126970 3:18995910-18995932 GCAGGGTATAGACCCCCTCCTGG + Intergenic
951192564 3:19787016-19787038 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
951289925 3:20863067-20863089 GCAGGGTATAGCCCCCCTCCTGG + Intergenic
951452152 3:22852061-22852083 GCAGGGTATAGCCCCCCTCGTGG + Intergenic
951756403 3:26096145-26096167 GCAGGGTATAGCTCCCCTCCTGG + Intergenic
952141206 3:30480781-30480803 GCAAGGTACAGCTCCCCTCCTGG - Intergenic
952170220 3:30799012-30799034 GCAGGGTATAGCCCCCATCATGG + Intronic
952435196 3:33266790-33266812 GCAGGGTATAGCCCCCTTCCTGG + Intergenic
952569867 3:34701561-34701583 GCAGGGTACAGCCCCACTCCTGG + Intergenic
952575870 3:34773551-34773573 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
952739763 3:36724006-36724028 GCAGGGTACAGCCTCTCTCCTGG - Intronic
952831350 3:37567836-37567858 GCAGGGTATAGCACCCCACCTGG + Intronic
953446684 3:42974466-42974488 GCAGGGTATAGCCCACCTCCTGG - Intronic
953503813 3:43463254-43463276 GCAGGGTACAGCCTCCCTCCTGG - Intronic
954219750 3:49145749-49145771 TAAAGGTTAAGCCCCTCTCCTGG + Intergenic
954431094 3:50471223-50471245 GCATGGCACAGCCCCTCTGCAGG - Intronic
954516989 3:51187126-51187148 GCAGGGTATAGCCCCTCTCCTGG - Intronic
954759514 3:52863950-52863972 GCAGGGTACAGCCTCCCTCCCGG + Intronic
954911863 3:54117388-54117410 GCAGGGTATAGCCCCCCTCCTGG - Intergenic
955471845 3:59294620-59294642 GCAGGGTATAACCTGTCTCCTGG + Intergenic
955970692 3:64435704-64435726 GCAGGGTATAGCCCCCTTCCTGG - Intronic
956246224 3:67186378-67186400 GCACGGTATAGCCCTGCTCCTGG + Intergenic
956306457 3:67831923-67831945 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
956938534 3:74131595-74131617 GCAGGGTACAGCCTCCCTCCCGG + Intergenic
957012882 3:75028187-75028209 GCAGGATATAGCTCCCCTCCTGG + Intergenic
957105594 3:75883376-75883398 GCAGGGCATAGCCCCCCTCCTGG + Intergenic
957160240 3:76601167-76601189 GCAGGATATAGCCCCAATCCTGG + Intronic
957267160 3:77982555-77982577 GCAGGGTATGGCCCCTCCCCCGG + Intergenic
957403714 3:79750035-79750057 GCAGGGTACAGCCTCCCTCCTGG - Intronic
957407451 3:79790254-79790276 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
957557473 3:81780512-81780534 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
957625262 3:82646922-82646944 GCAGGATATAGCCCCCCTCCTGG - Intergenic
957669350 3:83280804-83280826 GCAGGGCACAGCCTCTCTCCTGG + Intergenic
957896274 3:86424633-86424655 GCAGGGTATAGCCCCCCTCTTGG + Intergenic
957945423 3:87057337-87057359 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
957981782 3:87519946-87519968 GCAGGGTACAGCCTCTGTCCTGG - Intergenic
957987432 3:87589946-87589968 ACAGGGTACAGCCCCCCTCCTGG + Intergenic
958018450 3:87969335-87969357 GCAGGGTACAGCCTCCCTCCCGG - Intergenic
958042656 3:88245046-88245068 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
958146578 3:89631905-89631927 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
958463306 3:94426636-94426658 GTAAGGTACAGCTCCCCTCCTGG - Intergenic
958553261 3:95643241-95643263 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
958577760 3:95974315-95974337 GCAGGGTACAGCCTCTCTCCTGG - Intergenic
958588210 3:96118394-96118416 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
958672130 3:97219108-97219130 GCAGGGTACAGCTCCACTCCTGG + Intronic
958823423 3:99002408-99002430 GCAGGGTAGAGCCTCCCTCCTGG + Intergenic
958860300 3:99437466-99437488 GCAGGGCATAGCCCTCCTCCTGG - Intergenic
958861076 3:99445864-99445886 GCAGGGTATAGCCTCCCTCCTGG - Intergenic
959054504 3:101554065-101554087 GCAGGGTAAAGCCTCCCTCCTGG - Intergenic
959161071 3:102724977-102724999 ACAGGGTATAGCCCCCCTCCTGG - Intergenic
959202884 3:103271277-103271299 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
959439865 3:106361714-106361736 GCAAGGTACAACCCCCTTCCTGG - Intergenic
959507970 3:107176535-107176557 GCAGGGTATAATCCCTCTCCTGG - Intergenic
959729957 3:109590324-109590346 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
959754673 3:109883475-109883497 GCAGGGTATAGCCCCACTTCTGG + Intergenic
959815692 3:110671060-110671082 GCAGTGTATAGCCTCCCTCCTGG - Intergenic
959846657 3:111040840-111040862 GCAGGGTATAACCCCCCTCCTGG - Intergenic
959851864 3:111097075-111097097 GCAGGGTACAGCCTCCCTCCCGG - Intronic
959872262 3:111341694-111341716 GCAGGGTACAGCCTCCCTCCCGG - Intronic
959894053 3:111587242-111587264 GCAGGGTATAACTCCCCTCCTGG + Intronic
960021869 3:112964367-112964389 GCAGGGTACAGCCACCCTCCTGG - Intronic
960224989 3:115158221-115158243 GCAGGGTACAGCCCTCCTCCGGG - Intergenic
960499473 3:118419221-118419243 GCAGGGTACAGCCCCTCTCCAGG + Intergenic
961701950 3:128751331-128751353 GCAGGGTACAGCCTCCCTCCTGG - Intronic
961789314 3:129364494-129364516 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
961839477 3:129696932-129696954 GCAGGGTACAGCCCTGCTCCTGG + Intronic
962045825 3:131758230-131758252 GCAGGGTATAGCTTCCCTCCTGG - Intronic
962421539 3:135233469-135233491 GCAGGGTACAGCTCCCCTCCTGG + Intronic
962440135 3:135406028-135406050 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
962461064 3:135613016-135613038 GCAGGATACAGCTCCTCTCCTGG - Intergenic
962576966 3:136763669-136763691 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
962589373 3:136873170-136873192 GCAGAGTACAGCCTCTCTCCTGG - Intronic
962646367 3:137444814-137444836 GCAGGGTACAGCCCCACTTCTGG + Intergenic
963072779 3:141318753-141318775 GCAGGGTATAGCCTCCTTCCTGG + Intergenic
963379237 3:144507183-144507205 GCAGGGTGTAGCCTCCCTCCCGG + Intergenic
963391121 3:144665336-144665358 CCAGGGTACAGCCTCTCTCCTGG + Intergenic
963404370 3:144843930-144843952 GTAGGGTACAGCCCCACTCCTGG + Intergenic
963418395 3:145027936-145027958 GCAGGGTACAGCTTCTCTCCAGG - Intergenic
963422034 3:145073065-145073087 GCAGGGTACAGTCTCTCTCCTGG + Intergenic
963475116 3:145794539-145794561 GCAGGGTATAGCCTCCCTCCTGG + Intergenic
963517116 3:146322866-146322888 GCAGGGTACAGTCCCCCTCCTGG - Intergenic
963716737 3:148811970-148811992 GCAGGGTACAGCCTCCCTCCTGG - Intronic
963952885 3:151221942-151221964 GCAGGGTACAGCCTCCCTCCTGG - Intronic
964098541 3:152962396-152962418 GCAGGGTACAGCCTCCCTCCCGG + Intergenic
964427455 3:156568572-156568594 GCAGGCTATAGCCTCCCTCCCGG - Intergenic
964508596 3:157425404-157425426 TCAAGGTACAGCCTCCCTCCTGG - Intronic
965012085 3:163107193-163107215 GCAGAGTACAGCCCCCCTCCTGG + Intergenic
965045544 3:163572671-163572693 GCAGAGTACAGCCTCTCTCCTGG - Intergenic
965067817 3:163874976-163874998 GCAGGGTACAGCCTCTCTCCCGG - Intergenic
965264985 3:166531682-166531704 GCAGGGTAAAGTCCCCCTCCTGG + Intergenic
965270667 3:166613589-166613611 GCAGGGTACAGGCCCCCTCCTGG + Intergenic
965989635 3:174800741-174800763 GCAGGGTATAGCTCCCCTCCTGG - Intronic
966059128 3:175733978-175734000 GCAGGGTATAGCCCCCCTCCTGG + Intronic
966074354 3:175919088-175919110 GCAGGGTACAGCCCATCTCCTGG + Intergenic
966123340 3:176547720-176547742 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
966153651 3:176892693-176892715 GCAGGATATAGTCCCCCTCCTGG - Intergenic
966299481 3:178462283-178462305 GCAAGGTACAGCCTCCCTCCTGG - Intronic
966446520 3:180007354-180007376 GCAGGGTACAGCCTCCCTCCTGG + Intronic
966466210 3:180233585-180233607 GCAGGGTATAGCTCCCTTCCTGG + Intergenic
966722589 3:183079538-183079560 GCAGGGTATAGCCCCTCTCCTGG + Intronic
966733302 3:183168455-183168477 GCAGGGTACAGCCTCCCTCCAGG + Intergenic
967453402 3:189652214-189652236 GCAGGGTACAGCCCCCCTCCTGG - Intronic
967462244 3:189760566-189760588 GCAGGGTATAGCTTCCCTCCTGG + Intronic
967609208 3:191483557-191483579 GCAGAGTATAGCCTCCCTCCTGG - Intergenic
968392282 4:203498-203520 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
969486128 4:7473430-7473452 GCAGGGTGAAGCCCCTCTTCTGG - Intronic
969993006 4:11283618-11283640 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
969996374 4:11317112-11317134 GCAGGGTATTTCCCCACTCCTGG + Intergenic
970360507 4:15304270-15304292 GCGATGTATGGCCCGTCTCCAGG - Intergenic
970382074 4:15518387-15518409 GCAGGGTACAGCCTCCCTCCTGG + Intronic
970663532 4:18312095-18312117 GCAAGGTACAGACCCCCTCCTGG + Intergenic
970763325 4:19517357-19517379 GCAGGATATAGCCTCCCTCCTGG - Intergenic
970801280 4:19976203-19976225 GCAGGATATAGCCCCATTCCTGG + Intergenic
970868117 4:20782180-20782202 GCAGGGTACAGCCTCTCTCCAGG + Intronic
970987584 4:22176467-22176489 GCAGGATATAGCCCCCCTCCTGG + Intergenic
970999322 4:22304285-22304307 GCAGGGTATAGCCCCTCTCCTGG - Intergenic
971069920 4:23079858-23079880 GCAGGGTACAGCTCCCCTCCTGG + Intergenic
971119692 4:23689790-23689812 GCAGGGTATATCCCCACACCTGG - Intergenic
971546331 4:27891420-27891442 GCAGGGTACAGCCCCCGTCCTGG - Intergenic
971561475 4:28084142-28084164 GCAGGATACAGCCCCACTCCTGG + Intergenic
971687406 4:29787196-29787218 GCAAGGTACAGGCTCCCTCCTGG + Intergenic
971875376 4:32301321-32301343 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
971900261 4:32649818-32649840 TCAGGGTATAGCCCCACTCCAGG + Intergenic
972200015 4:36703047-36703069 GCAGGGTATAACCCCCTTCCTGG - Intergenic
972242030 4:37203803-37203825 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
972485239 4:39534228-39534250 GCAGGGTAAAGCCTCCCTCCAGG - Intergenic
972809292 4:42564398-42564420 GCAGGGTACAGCCTCCCTCCTGG - Intronic
973035152 4:45396963-45396985 GCAAGGTATAGCCCCCCTCCTGG + Intergenic
973107819 4:46361735-46361757 GTAGGGTATAGCCCTCCTCCTGG - Intronic
974013085 4:56625019-56625041 GCAGGGTAGAGCCTCCCTCCTGG - Intergenic
974101537 4:57422687-57422709 GCAGGGTACAGCCCCTCTCCTGG - Intergenic
974125726 4:57693301-57693323 GCAGGGTATGGCCCCACTCCTGG - Intergenic
974171406 4:58271041-58271063 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
974430549 4:61791474-61791496 GCAGGGTATGGCCTCCCTCCTGG + Intronic
974477857 4:62406399-62406421 GCAGGGTACAACCTCTCTCCTGG - Intergenic
974557035 4:63464576-63464598 GCAGGATACAGCGCCTCTCCTGG + Intergenic
974563417 4:63552811-63552833 GCAGGTTATAGCCTCCCTCCTGG + Intergenic
974716923 4:65679319-65679341 GCAGGGTACAGCCCCCCTCCTGG - Intergenic
974724230 4:65777950-65777972 GCAGGGTATAGGCCACCTCCAGG - Intergenic
974748205 4:66103151-66103173 GCAATGTATAGCCCTTCTCCTGG - Intergenic
974797152 4:66767174-66767196 GCAGGGTATAGCCCTCTTCCTGG - Intergenic
975038093 4:69709875-69709897 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
975040394 4:69739062-69739084 GCAAGGTACAGCCCCTCTCCTGG + Intronic
975204006 4:71623794-71623816 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
975285065 4:72607425-72607447 GCAGGGTACAGCCCCGCTTCTGG - Intergenic
975361259 4:73474845-73474867 GCAGGGTATAGTTCCTCTCCTGG + Intergenic
975506956 4:75148499-75148521 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
975542842 4:75532390-75532412 GCAGGGTACAGCCTCCCTCCTGG + Intronic
975796607 4:78012681-78012703 GCAGGGTATAGCCCCACTCCTGG - Intergenic
976042673 4:80906319-80906341 GCAGGGTACAGCCCCGCTCCTGG + Intronic
976050789 4:81009537-81009559 GCAGGGTACAGCCCCACTCCTGG - Intergenic
976051520 4:81016303-81016325 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
976127976 4:81854103-81854125 GCAGGGTATAGCTGCCCTCCTGG + Intronic
976461139 4:85314270-85314292 GCAGAGTATAGCCCCCCTCCTGG + Intergenic
976680727 4:87753247-87753269 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
977026035 4:91820693-91820715 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
977030524 4:91876779-91876801 GCAAGGTACATCCCCCCTCCTGG - Intergenic
977070242 4:92376423-92376445 GCAGGGTATAGCCTCCATCCTGG + Intronic
977197828 4:94083824-94083846 GCAGGGTATAGCCCCCATCCTGG + Intergenic
977435500 4:96989621-96989643 GCAAGGTATAGCCTCCCTCCTGG - Intergenic
977545110 4:98367582-98367604 GCAGGGTATAGCCCCCATCCTGG - Intronic
978101017 4:104841106-104841128 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
978145468 4:105366481-105366503 GCAGGGTACAGCCCCCCTCATGG - Intergenic
978256021 4:106693796-106693818 GTGGGGTACAGCCCCTCTCCAGG - Intergenic
978262276 4:106773992-106774014 GCAGGGTACAGCCCTCCTCCTGG - Intergenic
978856610 4:113401157-113401179 GCAGGGTATAGCCCCACTCCTGG - Intergenic
978904108 4:113985771-113985793 GCAGGGTACAGTCCCACTCCTGG - Intergenic
978981948 4:114957937-114957959 GCAGGGTAGAGCCCCCTTCCTGG + Intronic
979006774 4:115309020-115309042 GCAGAGTATAGCCCTTCTCCTGG - Intergenic
979038434 4:115754857-115754879 GCATGGTACAGCCCCACTCCTGG - Intergenic
979058873 4:116029905-116029927 GCAGGATACAGACCCTCTCCTGG - Intergenic
979183461 4:117758263-117758285 GCAGGGTACAGTCTCTCTCCTGG - Intergenic
979369176 4:119862863-119862885 GCAGGGTACAGCCTCCCTCCCGG + Intergenic
979411522 4:120384936-120384958 GCAGGGTATAGCCTCTCTCCTGG - Intergenic
979500437 4:121434159-121434181 GCCAGGTACAGCCTCCCTCCGGG + Intergenic
979715906 4:123837604-123837626 GCAAGACATAGTCCCTGTCCAGG + Intergenic
979922957 4:126524450-126524472 GCAAGGTACAGCCCTCCTCCTGG + Intergenic
980083549 4:128368939-128368961 GCAAGGTACAGCCCCCCTCCTGG + Intergenic
980266490 4:130523751-130523773 GCAGGGTACAGCCACCCTCCTGG + Intergenic
980280035 4:130707210-130707232 GCAGGGTACAGCCCCACTCCTGG + Intergenic
980310672 4:131125789-131125811 GCAGGGTATAGCCTTACTCCTGG + Intergenic
980532531 4:134073435-134073457 GCAGGGTATAGGCCCCCTGCTGG + Intergenic
980560052 4:134460668-134460690 GCAGGGTACAGCTCCACTCCTGG - Intergenic
980846699 4:138333095-138333117 GCAGGGCATAGCCCCCCTCCTGG + Intergenic
981695292 4:147553259-147553281 GCAGAGTATAGCCCCTCTCCTGG - Intergenic
982121199 4:152145323-152145345 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
982219461 4:153112321-153112343 GGAAGCTATAGGACCTCTCCTGG - Intergenic
982279191 4:153666373-153666395 GCAGGGTATGGCTCCCCTCCTGG - Intergenic
982394800 4:154904620-154904642 GCAAGTTATATACCCTCTCTAGG - Intergenic
982477176 4:155868017-155868039 GCAGGGTATAGCCCCCCTCCTGG + Intronic
982483027 4:155934545-155934567 GCAGGGTACAGCCTCCCTCCTGG - Intronic
983006442 4:162490726-162490748 GCAGGCTACAGCCACTCTCCTGG - Intergenic
983164622 4:164460069-164460091 GAAGGGTATAGCCCTGCTCCTGG - Intergenic
983236656 4:165187823-165187845 GCAGGGTATATCCCTCCTCCTGG + Intronic
983419569 4:167500505-167500527 GCAGAGTATAGCCCCCCTCCTGG + Intergenic
983431736 4:167659600-167659622 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
983460654 4:168022627-168022649 GCAGGGTACAGCCTCTCTCCTGG + Intergenic
983478312 4:168242406-168242428 GCAGGGTATAGTGCCCCTCCTGG - Intronic
983489237 4:168368683-168368705 GCAGGGTACAGCCTCCCTCCTGG - Intronic
983657436 4:170097851-170097873 GAAGGGTATAGCCCCGCTTCTGG + Intergenic
983874813 4:172863366-172863388 GCAGGGTACAGCCCCCTTCCTGG - Intronic
984131218 4:175878139-175878161 GCAGGGTACAGCCTCCCTCCTGG + Intronic
984219421 4:176955188-176955210 GCAGGGTATAGCCCCTATCCTGG + Intergenic
984353168 4:178621778-178621800 GCAGGGGATAGCCTCCCTCCTGG + Intergenic
985094961 4:186403993-186404015 GCAGGGTACAGCCTCTCCCCTGG + Intergenic
985220364 4:187697298-187697320 ACAGGGTACAGCCCCACTCCTGG - Intergenic
985431773 4:189888110-189888132 GCAGGGTACAGCCCTTCTCCTGG + Intergenic
985474170 5:68860-68882 GCAGGGTACAGCCCCCCTTCTGG - Intergenic
985852994 5:2402397-2402419 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
986563396 5:9085859-9085881 GCAGGGTACAGCCTCCCTCCTGG - Intronic
986680040 5:10224317-10224339 GCAGGGTATAGCCTCCCTCCTGG + Intergenic
986852497 5:11829874-11829896 GCAGGGTACAGCCTCCCTCCTGG - Intronic
986867591 5:12008063-12008085 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
986873380 5:12078330-12078352 GCAGGGTACAGCCTCTTTCCTGG + Intergenic
986933880 5:12858995-12859017 GCAGGGTACAGCCCCACTCCTGG - Intergenic
987097870 5:14566139-14566161 ACAGGGTATAGCCCCCCTCCTGG + Intergenic
987102518 5:14604849-14604871 GCAGGGTACAGCCTCCCTCCTGG + Intronic
987254734 5:16138677-16138699 GCAGGGTACAGCCCCTATCCTGG - Intronic
987260338 5:16196182-16196204 GCAGGGTATAGTCCCCCTCCTGG + Intergenic
987262008 5:16213671-16213693 GCATTGTACAGCCTCTCTCCTGG + Intergenic
987457512 5:18165394-18165416 TCATGGTACAGCTCCTCTCCTGG + Intergenic
987462050 5:18223642-18223664 GCAGGGTATAGCCCCCCTCCTGG - Intergenic
987511629 5:18847421-18847443 GCAGGGCATAGCCCCCCTCCTGG + Intergenic
987586488 5:19863271-19863293 GAAAGGGATAGCCCCTCCCAGGG - Intronic
987602042 5:20084380-20084402 GCAGGGTACAGCCTCTCTCCTGG + Intronic
987612380 5:20223134-20223156 GCAGGGTACAGCTCCCCTCCTGG - Intronic
987655513 5:20800678-20800700 GCAGGGTACAGCCTCTCTCCTGG - Intergenic
987693376 5:21297231-21297253 GGAAGGTAGCGCCCCACTCCTGG - Intergenic
987723036 5:21663280-21663302 GCAGGGTATAGCCCCCCTCCTGG + Intergenic
987884913 5:23800600-23800622 GCAGGGTATAGCCCACCTCCTGG - Intergenic
987984951 5:25134343-25134365 GCAGGGTATAGCTTCCCTCCTGG - Intergenic
988028159 5:25727041-25727063 TTCAGGTATAGCCTCTCTCCTGG + Intergenic
988091056 5:26542076-26542098 GCAGGGTATAGCCCCTCTCCTGG - Intergenic
988221183 5:28348931-28348953 GCATAGTATAGCCCTCCTCCTGG + Intergenic
988236386 5:28550812-28550834 GCAGGGTCCAGCCCCCCTCCTGG + Intergenic
988335979 5:29909629-29909651 GCAGGGTATAGCTCCACTTCTGG + Intergenic
988400514 5:30754555-30754577 GCAGGGTACAGCCCCACTCCTGG - Intergenic
988426798 5:31074024-31074046 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
988628271 5:32900637-32900659 GCAGGGTACAGCCCCTGTCCTGG + Intergenic
988768041 5:34403215-34403237 GCAGGGTACAGCCTCTTTCCTGG + Intergenic
988928600 5:36013872-36013894 GCAGGGTAAAGCCTCTCTCCTGG - Intergenic
989067745 5:37481117-37481139 GCAGGGTACAGCCCCCCTTCTGG + Intronic
989132737 5:38124000-38124022 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
989144526 5:38235411-38235433 GCAGGGTACAGCCACCCTCCTGG - Intergenic
989673367 5:43946102-43946124 GCAGGGTATAGCCACTCTCCTGG + Intergenic
989966925 5:50475524-50475546 GCAAGGTATAGCCCCACTCCTGG - Intergenic
990021179 5:51128928-51128950 GCAGGGTACAGCCCCCCTCCTGG - Intergenic
990075692 5:51843619-51843641 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
990264648 5:54061924-54061946 GCAGGGTACAGCCTCCCTCCTGG - Intronic
991039235 5:62159052-62159074 GCAGGGTACAGCCTCCCTCCCGG - Intergenic
991206929 5:64060163-64060185 GCAGGGTAAAGCACCCCTCCTGG - Intergenic
991735770 5:69630363-69630385 GCAGGGTACAGCCCCCCTTCTGG - Intergenic
991738898 5:69651651-69651673 GCAGGGTACAGCCCCCCTTCTGG - Intergenic
991746898 5:69752321-69752343 GGAAGGTAGCGCCCCACTCCTGG + Intergenic
991750807 5:69802921-69802943 GGAAGGTAGCGCCCCACTCCTGG - Intergenic
991759300 5:69904780-69904802 GCAGGGTACAGCCCCCCTTCTGG + Intergenic
991788036 5:70213342-70213364 GCAGGGTACAGCCCCCCTTCTGG - Intergenic
991790473 5:70231392-70231414 GCAGGGTACAGCCCCCCTTCTGG - Intergenic
991798500 5:70332263-70332285 GGAAGGTAGCGCCCCACTCCTGG + Intergenic
991812264 5:70486002-70486024 GCAGGGTACAGCCCCCCTTCTGG - Intergenic
991815223 5:70506479-70506501 GCAGGGTACAGCCCCCCTTCTGG - Intergenic
991818359 5:70527768-70527790 GCAGGGTACAGCCCCCCTTCTGG - Intergenic
991826275 5:70627633-70627655 GGAAGGTAGCGCCCCACTCCTGG + Intergenic
991830095 5:70677818-70677840 GGAAGGTAGCGCCCCACTCCTGG - Intergenic
991838529 5:70779846-70779868 GCAGGGTACAGCCCCCCTTCTGG + Intergenic
991880483 5:71213706-71213728 GCAGGGTACAGCCCCCCTTCTGG - Intergenic
991882920 5:71231727-71231749 GCAGGGTACAGCCCCCCTTCTGG - Intergenic
991890831 5:71331586-71331608 GGAAGGTAGCGCCCCACTCCTGG + Intergenic
992153994 5:73936624-73936646 GCAAGTCATTGCCCCTCTCTGGG - Intronic
992215894 5:74524364-74524386 GCAGGGTATAACCTCCCTCCTGG - Intergenic
993146183 5:84096311-84096333 GCAGGGTACAGCCTCCCTCCTGG - Intronic
993215824 5:85021598-85021620 GCAGGGTATACCCCTACTCCTGG + Intergenic
993260785 5:85655583-85655605 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
993293864 5:86109418-86109440 GCAAGGTATAGCCCCCATCCTGG - Intergenic
993590570 5:89790390-89790412 GCAGGGTACAGCCCGCCTCCTGG + Intergenic
993638188 5:90370971-90370993 GTACATTATAGCCCCTCTCCTGG + Intergenic
993723927 5:91347548-91347570 GCAGGGGATAGCCTCCCTCCTGG + Intergenic
993753583 5:91700724-91700746 GCAGGGTATAGCCTCCCTCTTGG + Intergenic
993967123 5:94372155-94372177 GAAGGATATAGCCCCCCTCCTGG + Intronic
993985708 5:94594998-94595020 TCAGGGTATAGTCCCCCTCCTGG + Intronic
994234197 5:97342545-97342567 GCAGGTTATAGCCCCACTCCTGG + Intergenic
994338836 5:98601245-98601267 GCAGGGTACAGCCCCCCTCCTGG - Intergenic
994421106 5:99527053-99527075 GCAGGGTACAGCCCCCCTTCTGG + Intergenic
994434266 5:99707989-99708011 GCAGGGCATAGCCTCTCTCCTGG + Intergenic
994485935 5:100387261-100387283 GCAGGGTACAGCCCCCCTTCTGG - Intergenic
994548787 5:101205317-101205339 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
994552836 5:101259034-101259056 GCAGGGTATAACCCTCCTCCTGG - Intergenic
994553220 5:101262573-101262595 CCAGGGTATAGCCCCTCTCCTGG - Intergenic
994637631 5:102363110-102363132 GCAGGATATAGGCCCTCTCCTGG + Intergenic
994649130 5:102504632-102504654 GCAGGGTATAGCCCCCCTCTCGG - Intergenic
994823373 5:104681031-104681053 GTAGGGTATAGCACCCCTCCTGG - Intergenic
995113567 5:108454251-108454273 GCAGGGTATAGGCCCCCTCCTGG - Intergenic
995129338 5:108613144-108613166 GCAGGGTATAGCACCCCTCGTGG - Intergenic
995312632 5:110731220-110731242 GCAGGTTATAGCCTCCCTCCTGG + Intronic
995590933 5:113699104-113699126 GCAGGGTATAGCCCACCTCCTGG + Intergenic
995608152 5:113880367-113880389 GCAGGGTACAGCCTCACTCCTGG - Intergenic
995698377 5:114905419-114905441 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
995791393 5:115891806-115891828 GCAGGGTACAGCCTCCCTCCTGG - Intronic
995828578 5:116329192-116329214 GCAGGGTAAAGCCCCTCTCCTGG + Intronic
995988742 5:118210172-118210194 GCAAGATACAGCCTCTCTCCTGG - Intergenic
996011191 5:118483364-118483386 GCAAGGAACAGCCTCCCTCCCGG + Intergenic
996098164 5:119420886-119420908 GCAGGGTACAGCCCCACTCCTGG - Intergenic
996222448 5:120950170-120950192 GCAGGGTATAGCCTCCCTTCTGG - Intergenic
996255927 5:121402979-121403001 GCAGGGTACAGCCACCCTCCTGG - Intergenic
996617453 5:125458289-125458311 GCAGGGTATAGCCTCCCTCCTGG - Intergenic
996636189 5:125692396-125692418 GCAGGGTATAGCCTCCCTCCCGG - Intergenic
996670651 5:126113516-126113538 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
996774693 5:127120897-127120919 GCAGGGTATAGCCTCCCTTCTGG + Intergenic
996911438 5:128660965-128660987 GCAGGGTATAGCCTCCCTCCCGG - Intronic
996967251 5:129320914-129320936 GCAGGGTACAGCCTCACTCCTGG + Intergenic
997021989 5:130013195-130013217 GCAGGGTACAGCCCCCCTCCTGG + Intronic
997036788 5:130202557-130202579 GCAGGGTATAGCCCCTCTCCTGG + Intergenic
997086527 5:130806449-130806471 GTAGGGTACAGCCCCACTCCTGG - Intergenic
997108192 5:131045624-131045646 GCAGGGTATAGTCTCCCTCCTGG + Intergenic
997274568 5:132573950-132573972 GCAGGGTATAGCCTCCTTCCTGG + Intronic
997491827 5:134284066-134284088 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
998144720 5:139720632-139720654 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
998697046 5:144652513-144652535 GCAGGGTATAGGCCCCCTCCTGG + Intergenic
998889407 5:146730058-146730080 GCAGGGTATAGCCTCCCTCCTGG - Intronic
999297087 5:150466402-150466424 ACAAGTCATAGCCCCTCTCTGGG + Intergenic
999473747 5:151879065-151879087 GCAGGGTAGAGCCTCCCTCCTGG - Intronic
999541139 5:152573461-152573483 GCAGGGTACAGCTCCCCTCCTGG - Intergenic
1000030445 5:157396937-157396959 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1000229051 5:159298121-159298143 GCAAGGTACAGCCTCTCTCCCGG + Intergenic
1000496291 5:161989386-161989408 GCAGGGTATAGCCCCCCTCCTGG + Intergenic
1000515504 5:162233119-162233141 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1000648378 5:163785473-163785495 GCAGGGTATAGCCCCCTTCCTGG + Intergenic
1000659550 5:163920669-163920691 GTAGGGTACAGCTCCTCTCCTGG - Intergenic
1000676279 5:164126608-164126630 GCAGGGTATAGCCCCCCTCCTGG + Intergenic
1000741519 5:164975101-164975123 GCAGGGTATAGCCCCCATCCTGG - Intergenic
1000947255 5:167437156-167437178 GTAGGGTATAGCCCCCCTCCTGG - Intronic
1001181608 5:169525920-169525942 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
1001281567 5:170389806-170389828 GCAAGTTATGGCACCTCTCTGGG + Intronic
1001473339 5:172031574-172031596 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
1001684866 5:173585847-173585869 GCAGGGTATAGCCTCCCTCCTGG + Intergenic
1001795563 5:174499280-174499302 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1002464624 5:179400678-179400700 GCAGCGTATAGCCCCTCTCCTGG - Intergenic
1002869882 6:1157145-1157167 GCAGGGTATAGCCCCCTTCCTGG - Intergenic
1003227388 6:4218615-4218637 GCAGGGTACAGCCCCTCTCCTGG + Intergenic
1003228002 6:4223734-4223756 GCAAGGTAGAGCCTCCCTCCTGG - Intergenic
1003401698 6:5796073-5796095 GCAAGGTATAGCCTCCCTCCTGG + Intergenic
1004273148 6:14212437-14212459 GTGAGGTATAGACCCTCTCTGGG + Intergenic
1004805666 6:19201494-19201516 GCAAGGTACAGCCTCCCTCCTGG + Intergenic
1004826900 6:19432542-19432564 TCAATGTATAGCCCTTCCCCAGG - Intergenic
1004830786 6:19475029-19475051 GCAGGGTACAGCCTCCCTCCCGG + Intergenic
1004909478 6:20269022-20269044 GAAAACTATAGCCCCTCTTCTGG - Intergenic
1005180229 6:23096033-23096055 GCAGGGTACAGCCCTTCTCCTGG - Intergenic
1005217998 6:23554359-23554381 GCAGGGTACAGCCTCTCTCCTGG + Intergenic
1005548701 6:26894743-26894765 GCAGGGTACAGCCCCCCTTCTGG - Intergenic
1005984078 6:30859689-30859711 ACATGGTACAGCCCCTCTTCTGG + Intergenic
1006452045 6:34110923-34110945 ACAAGGAACAGCCTCTCTCCAGG + Intronic
1006697199 6:35941063-35941085 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1008153904 6:47989962-47989984 GCAGGGTAGAGTCCCCCTCCTGG - Intronic
1008220819 6:48851951-48851973 GCAGGGTAGAGCCCCCTTCCTGG + Intergenic
1008332689 6:50262240-50262262 GCAGGGTATAGCCTCATTCCTGG + Intergenic
1008681403 6:53876790-53876812 GCAGGGTATAACCCCTTACCTGG + Intronic
1008756187 6:54797598-54797620 GCATGGTACAGCCTCCCTCCTGG - Intergenic
1009019456 6:57935855-57935877 GCAGGGTACAGCCCCCCTTCTGG - Intergenic
1009346152 6:62614631-62614653 GCAGAGTATAGCCTCCCTCCTGG - Intergenic
1009503204 6:64443070-64443092 GCAGGGTACAGCTTCTCTCCTGG - Intronic
1009532903 6:64843394-64843416 TCAGGGTATAGCCCACCTCCGGG - Intronic
1009538611 6:64923864-64923886 GCAGGGTACAGCCCCCCTCCTGG + Intronic
1009605051 6:65857071-65857093 GCAGGGTACAGCCCACCTCCTGG + Intergenic
1009726114 6:67537620-67537642 GCAGGGTATAGCCCCACTCTTGG - Intergenic
1009726606 6:67543295-67543317 GCAGGGTACGGCCCCACTCCTGG - Intergenic
1009804887 6:68590418-68590440 GCAGGGTAAAGCTCCCCTCCTGG + Intergenic
1009982352 6:70741534-70741556 GCAGGGTATAGCCTCCCTCCTGG + Intronic
1010324039 6:74544612-74544634 GAAGGGTATAGCCCCCCTCCTGG + Intergenic
1010735807 6:79442857-79442879 GCAGGGTATAACCCCTCTCCTGG + Intergenic
1010810365 6:80293008-80293030 GCAGGGTACAGCCCCTCTCCTGG + Intronic
1010882989 6:81202171-81202193 GCAGGGTACAGCCCTTCTCCTGG - Intergenic
1011031790 6:82931476-82931498 GCAGGGTACAGCCCCCCTCCTGG - Intronic
1011032979 6:82942990-82943012 GCAGGGTACAGCCCCCCTCCTGG - Intronic
1011088678 6:83571042-83571064 GCAGGGTATAGCCCTCCTCCTGG - Intronic
1011211266 6:84958881-84958903 GCAGGGTACAGTCCCACTCCTGG - Intergenic
1011236880 6:85228096-85228118 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1011348968 6:86401689-86401711 GCAGGGTAGAGCCCCCCTCCTGG + Intergenic
1011382781 6:86760360-86760382 GAAAGGTACAGCCCCTTGCCTGG - Intergenic
1011439107 6:87369045-87369067 GCAGGGTATAGCCCCCCTCCTGG + Intronic
1011559193 6:88598061-88598083 GCAGGGTATGGCTTCTCTCCAGG + Intergenic
1011792766 6:90915910-90915932 GCAGGGTACAGCCCTCCTCCTGG - Intergenic
1011876325 6:91966326-91966348 GCAGGGTACAGCCCCCCTTCTGG - Intergenic
1012700472 6:102451095-102451117 GCAGAGTACAGCCTCTCTCCAGG + Intergenic
1012755802 6:103228415-103228437 ACAGGGTACAGCTCCTCTCCTGG - Intergenic
1012826312 6:104151340-104151362 GCAAGGTACAGCCTCCCTCCCGG + Intergenic
1013077070 6:106781041-106781063 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1013151137 6:107447613-107447635 GCAGGGAACAGCCCCTCTCCTGG + Intronic
1013214515 6:108015336-108015358 GCAGGGTACAGGCCCCCTCCTGG + Intergenic
1013404659 6:109832033-109832055 GCAGGGTACAGTCTCTCTCCTGG - Intergenic
1013502985 6:110771008-110771030 GCAGGGTATAGCCCCCCTCCTGG + Intronic
1013558709 6:111283377-111283399 GCAAGGTATAGCCTCCCTCGTGG + Intergenic
1014133929 6:117866266-117866288 GCCAGGTACAGCCCCCCTCCTGG + Intergenic
1014407047 6:121065005-121065027 GCAGGGTACAGTCTCTCTCCTGG - Intergenic
1014576618 6:123081902-123081924 GCAGGGTATAGCCTCAATCCTGG + Intergenic
1014721219 6:124920509-124920531 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
1014771031 6:125458322-125458344 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1014863187 6:126496329-126496351 GCAGGGTACAGCCCCCTTCCTGG + Intergenic
1014895259 6:126893113-126893135 GCAAGGTACAGTCCCCTTCCTGG - Intergenic
1015110660 6:129588532-129588554 GCAGGGTACAGACCCCCTCCCGG + Intronic
1015130525 6:129803740-129803762 GCAGGGTATAGCCCTTCTCCTGG - Intergenic
1015239657 6:131008639-131008661 GCAGGGTACAGCCCCACTCCCGG - Intronic
1015351606 6:132225900-132225922 GCAGGGTACAGCCCCCCTCCTGG - Intergenic
1015674250 6:135726534-135726556 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1015899160 6:138047073-138047095 GCAGGGTACAGCCTCTCTCCTGG + Intergenic
1015901800 6:138075351-138075373 GCAAGGTACAGCCTCCCTTCTGG - Intergenic
1015995824 6:138994471-138994493 GCAAGGTACAGCCCCCCTCCTGG - Intergenic
1016106548 6:140170974-140170996 GCAGGGTAAAGCCTCCCTCCCGG + Intergenic
1016122806 6:140364470-140364492 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1016142216 6:140626688-140626710 TCAGGGTACAGCCCCACTCCTGG + Intergenic
1016230681 6:141800516-141800538 GCAGGTTATAACCCCCCTCCTGG - Intergenic
1016284913 6:142462465-142462487 GCAGGGTATAGCCCTCCTCCTGG + Intergenic
1016296031 6:142574434-142574456 GCAGGGTACAGCCCCTCTTCTGG - Intergenic
1016537681 6:145126665-145126687 GCAGGGTATAGCCTCCCTCCTGG - Intergenic
1016579768 6:145616629-145616651 GCAGGGTATAGCCCCCCTGCTGG - Intronic
1016592920 6:145766186-145766208 GCAGGGTACAGCCCTTCTCTTGG - Intergenic
1016595200 6:145790682-145790704 GCAGGGAATAGCCCCTCTCCTGG + Intergenic
1016987941 6:149909158-149909180 GCAAGGTTCAGCCCCTCTCCTGG - Intergenic
1018416279 6:163604938-163604960 GCAGGGTACAGCCCCACTCCTGG - Intergenic
1018466181 6:164047670-164047692 GCAGGGTATAGCCCCACTCCTGG - Intergenic
1018477666 6:164159280-164159302 GCAGGATACAGCTCCTCTCCTGG + Intergenic
1018482477 6:164205723-164205745 GCAGGATATAGCCCCCCTCCTGG - Intergenic
1018511193 6:164526419-164526441 GCAGGGTACAACCCCACTCCTGG - Intergenic
1018573787 6:165236987-165237009 GCAGGGTACAGCTCCTCTCCTGG - Intergenic
1019150375 6:170001511-170001533 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1020248658 7:6449972-6449994 GCCAGGAATAGCCCCCCTGCAGG + Intronic
1020345124 7:7154225-7154247 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1020470169 7:8526073-8526095 GCAGGATACAGCCTCTCTCCTGG - Intronic
1020537814 7:9424003-9424025 GCAGGGTACAGCCTCTCTCCTGG + Intergenic
1020550442 7:9597056-9597078 GCAGGGTACAGCTCCTCTCCTGG - Intergenic
1020611249 7:10400995-10401017 GCAGGGTATTGCCCCACTCCTGG + Intergenic
1021323429 7:19239535-19239557 GCAGGGTACAGTCCCCCTCCTGG + Intergenic
1021403846 7:20240997-20241019 GCAAGGTATTTCACCTCTTCAGG + Intergenic
1021882920 7:25111452-25111474 GCAGGGTATGGCCTCCCTCCTGG - Intergenic
1022018590 7:26376758-26376780 GCACGGTGTAGCCCCTCCTCCGG - Intergenic
1022678444 7:32522295-32522317 GCAGGGTACAGCCTCCCTCCCGG - Intronic
1023786944 7:43717272-43717294 GCAGGGCATAGCCTCCCTCCAGG - Intronic
1024137879 7:46429464-46429486 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1024207613 7:47177269-47177291 GCAGGGTACAGCCTCCCTCCCGG - Intergenic
1024232390 7:47372527-47372549 GCACAGGATAGTCCCTCTCCTGG + Intronic
1024424705 7:49212343-49212365 GCAGAGTATAGCCCTCCTCCTGG + Intergenic
1024667317 7:51559694-51559716 GCAGGGTACAGCCCCTCTCCTGG - Intergenic
1024771734 7:52731553-52731575 GCAGGGTACAGCCTCTCTCCTGG - Intergenic
1025285830 7:57659917-57659939 GCAGGGTATAGCCCACCTCCTGG - Intergenic
1025300321 7:57814831-57814853 GCAGGGTATAGCCCACCTCGTGG + Intergenic
1025725294 7:64052716-64052738 GCAGGGTATAGCCCCCCTCCTGG - Intronic
1027458651 7:78424605-78424627 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1027977636 7:85179330-85179352 GCAAGGTACAGCCCCACTCCTGG - Intronic
1028045116 7:86108056-86108078 GCAAGGTACAGCCCCATTCCCGG - Intergenic
1028066511 7:86391550-86391572 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1028516228 7:91680746-91680768 GCAGGGTACAGCCCCACTCCAGG + Intergenic
1028668296 7:93372130-93372152 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1028745254 7:94320183-94320205 GCAAGGTACAGCCTCCCTCCTGG + Intergenic
1028957821 7:96713452-96713474 GCAGGGTACAGCCTCTCTCCTGG - Intergenic
1028960994 7:96749752-96749774 GCAGGGTACAGCCCCCCTCTTGG + Intergenic
1029939411 7:104464270-104464292 GCAGGGTACAGCCCCCTTCCTGG + Intronic
1030415530 7:109238517-109238539 GCAGGGTATGGCCCCACTCCTGG - Intergenic
1030459103 7:109808379-109808401 GCAAGGTATAGTCCCTTTCCTGG - Intergenic
1030722338 7:112884675-112884697 GCAGGGTACAGCCCCTCTCCTGG + Intronic
1030826870 7:114169275-114169297 GCAGGGTACAGCCTCCCTCCCGG - Intronic
1030851008 7:114486881-114486903 GCAGGGTACAGCCCCCATCCTGG + Intronic
1030904226 7:115162801-115162823 GCAGGGTATAGCCTCCCTACTGG + Intergenic
1030967117 7:116006310-116006332 GCAGAATGTAGCCCCTCTCCTGG - Intronic
1031158240 7:118135733-118135755 GCAGGGTACAGCCTCCCTCCCGG - Intergenic
1031186000 7:118481197-118481219 GCAGGGTACAGCCCACCTCCTGG + Intergenic
1031473215 7:122191713-122191735 GCAAGGTACAGCCTCTCTCCTGG - Intergenic
1031783350 7:125997852-125997874 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1032427390 7:131832819-131832841 GAAAGGTCTCTCCCCTCTCCTGG - Intergenic
1033031544 7:137832083-137832105 GCAGGGTATAGCCCCTCTCCTGG + Intronic
1033072890 7:138220966-138220988 GCAGGGTACAGCCTCCCTCCCGG - Intergenic
1033225043 7:139554637-139554659 GCAGGGTATGGCCTCCCTCCCGG - Intergenic
1033256235 7:139804115-139804137 GCTGGGTATAGCCCCCCTTCTGG - Intronic
1033721141 7:144060528-144060550 GCAGGGTACAGCCCCTCTCCTGG - Intergenic
1033759933 7:144427238-144427260 GCAGGGTACAGCCTCTCTCCTGG + Intergenic
1033833119 7:145276791-145276813 GCAGGGTATAGCACCCCTTCTGG - Intergenic
1033871807 7:145762963-145762985 ACAGGGTATAGCCCCTCTCCTGG - Intergenic
1033885087 7:145934414-145934436 GCAGGGTACAGCCCCCCTGCTGG - Intergenic
1033953372 7:146813293-146813315 GCAGGGTATAGCCCTTCTGTTGG - Intronic
1033998686 7:147385673-147385695 GCAAGGTATAGCCCCCTTCCTGG + Intronic
1034623127 7:152471670-152471692 GCAGGCTATAGCCTCCCTCCTGG - Intergenic
1034750996 7:153569037-153569059 GCAGGGTATAGGCCCTCTCCTGG + Intergenic
1037206060 8:16321149-16321171 GCAGGGTACAGCCCCCCTCCTGG - Intronic
1037243432 8:16804184-16804206 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1037263991 8:17037764-17037786 GCAGGGTACAGCCCCACTCCCGG - Intronic
1037975685 8:23209477-23209499 GCAAGGTATAGCGCCCCTCCTGG - Intronic
1038139091 8:24822861-24822883 GCAGGGTATAGCCCCACTCCCGG - Intergenic
1038880413 8:31605149-31605171 GCAGGGTACAGCCCCCTTCCTGG + Intergenic
1039511419 8:38095040-38095062 ACAGGGTACAGCCCCACTCCTGG - Intergenic
1039657226 8:39423177-39423199 GCAGGGTATAGCCTCCCTCCTGG + Intergenic
1040741382 8:50580027-50580049 GCAGGGTATAGCTCCCCTCCTGG - Intronic
1041075034 8:54161453-54161475 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1041222995 8:55670451-55670473 GCAGGGAATAGCCCCACTCCTGG - Intergenic
1041339133 8:56823196-56823218 GCAGAGTATAGCCCACCTCCTGG - Intergenic
1041823802 8:62068629-62068651 GCAGGGTACAGCCCCACTCCCGG - Intergenic
1041825878 8:62095906-62095928 GCAGGATACAGCCCCACTCCTGG + Intergenic
1042602588 8:70512910-70512932 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1042622010 8:70717121-70717143 GCAGGGTACAGCCCCACTCCAGG + Intronic
1042631466 8:70821324-70821346 GCAGGGTACAGCCCCTGTCCTGG + Intergenic
1042635369 8:70868103-70868125 GCAGGGTATAGCTTCTCTCCTGG + Intergenic
1042646029 8:70987582-70987604 GCAGGGTATAGCCCCACTTCTGG + Intergenic
1042728297 8:71902836-71902858 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1042827223 8:72991450-72991472 GCAGGGTACAGCCCCACTCCCGG - Intergenic
1042953547 8:74225161-74225183 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1042992416 8:74655882-74655904 GCAGGGTATAGGCCCCCTCCTGG - Intronic
1043062083 8:75517679-75517701 GCAGGGTACAGCCCCCCTCCTGG + Intronic
1043262496 8:78219919-78219941 GCAGGGTGCAGACCCTCTCCTGG + Intergenic
1043275329 8:78385463-78385485 GCAGGGTACAGCTCCTCTCCTGG - Intergenic
1043317436 8:78939299-78939321 GCAGGGTACAGCCCCACTCTTGG - Intergenic
1043623818 8:82230049-82230071 GCAGGGTAAAGCCTCCCTCCTGG - Intergenic
1043644395 8:82499087-82499109 GCAGGGTACAACCCCACTCCTGG - Intergenic
1043940398 8:86189926-86189948 GCAGGGTACAGCCCTGCTCCTGG + Intergenic
1043993178 8:86780962-86780984 GCAGGGTATAGCCCCTCTCCTGG - Intergenic
1044538180 8:93381415-93381437 GCAGGGTACAGCCCCCCTCTTGG + Intergenic
1044760664 8:95514236-95514258 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1044877254 8:96681752-96681774 GCAGGGTATAGCCCCCCTCCTGG - Intronic
1045214115 8:100129908-100129930 GCAGGGTATAGCCTTCCTCCTGG + Intronic
1045617833 8:103938971-103938993 GCAGAGTATAACCCCCCTCCTGG + Intronic
1045675920 8:104607895-104607917 GCAGGGTATAGCCCCGCTTCAGG - Intronic
1045702318 8:104881150-104881172 GTAAGTGATAGCCCTTCTCCAGG - Intronic
1045732212 8:105255658-105255680 GCATGGTACAGCCTCCCTCCTGG + Intronic
1045884367 8:107078565-107078587 GCAGGGTATAGCTCCCCTCCTGG + Intergenic
1045894863 8:107202663-107202685 GCAGGGTACAGCCCCACTGCTGG + Intergenic
1046146875 8:110172115-110172137 GCAGGGTACAGCCCCACTCCTGG - Intergenic
1046161789 8:110376163-110376185 GCAGGGTATAGCCCCCTTCCTGG - Intergenic
1046180065 8:110633475-110633497 GCACTGTACAGCCCCACTCCCGG - Intergenic
1046368708 8:113271849-113271871 GCAGGGTATAGCACCACTTCTGG - Intronic
1046880152 8:119298916-119298938 GCAAGGTACAGGCCCTATCCTGG + Intergenic
1047153719 8:122294304-122294326 GCAGAGTACAGCCCCCCTCCTGG + Intergenic
1047194972 8:122712955-122712977 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1047490368 8:125369584-125369606 GCAGGGTGTAGCACCTCTTCTGG + Intergenic
1047565638 8:126040807-126040829 GCAAAGTAGAGCCTCCCTCCCGG - Intergenic
1047628111 8:126677549-126677571 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1047742486 8:127818012-127818034 GCTAGTTACTGCCCCTCTCCTGG - Intergenic
1047941395 8:129830539-129830561 GCAGGGTATAGCCTCCCTCCTGG + Intergenic
1048116757 8:131532198-131532220 GCAGGGTACAGGCCCTCTCCTGG - Intergenic
1048217547 8:132510180-132510202 GCAGGGTATAGCCTCCCTCTTGG + Intergenic
1048416747 8:134235275-134235297 GCAGGGTACAGCCTCCCTCCAGG + Intergenic
1048505050 8:135013458-135013480 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1048660946 8:136600297-136600319 GCATGGTACAGCCTCCCTCCTGG - Intergenic
1048895725 8:138990583-138990605 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1048915902 8:139182403-139182425 TCAGGGTACAGCCCCACTCCTGG - Intergenic
1049076354 8:140399399-140399421 GCAGGGTACAGCCCCTGTCCTGG - Intronic
1049085708 8:140477150-140477172 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1049814298 8:144591020-144591042 GCCAGGAATTGCCCCACTCCAGG - Intronic
1049825641 8:144665988-144666010 GCAGGGTATAGCCTCCCTCCTGG - Intergenic
1049903107 9:189222-189244 GCAGGGTACAGCCTCTCTCCAGG + Intergenic
1050079853 9:1904628-1904650 GCAGGGTATAGCCCTCCTCTTGG - Intergenic
1050086605 9:1972541-1972563 GCAGGTTACAGCCCCCCTCCTGG - Intergenic
1050255324 9:3787358-3787380 GCAAGGTACAGCTCTCCTCCTGG + Intergenic
1050773557 9:9233860-9233882 GTAGGGTATAGTCACTCTCCTGG + Intronic
1050849356 9:10264345-10264367 GCAGGGTACAGCCCCTCTCCTGG - Intronic
1051089119 9:13385502-13385524 GCAGGGTATATCCTCACTCCTGG - Intergenic
1051267591 9:15323648-15323670 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1051268135 9:15328401-15328423 GCAGGGTACAGCCCTCCTCCTGG + Intergenic
1051478808 9:17537863-17537885 GCATGGTTAAGCCCCTCACCAGG + Intergenic
1051743839 9:20276457-20276479 GCAGGGTACAGCCCCACTCCTGG + Intergenic
1052079019 9:24180274-24180296 GCAGGGTACAGCCCCTCTCCTGG + Intergenic
1052080865 9:24203747-24203769 GCAGGGTATAGTTCCCCTCCTGG - Intergenic
1052087912 9:24290834-24290856 GCAGGGTACAGCCCCTCTCCTGG + Intergenic
1052093402 9:24356861-24356883 GCAAAGTATGGCCCCCCTCCTGG + Intergenic
1052124314 9:24756240-24756262 GCAGGGTATAGCCCCCCTCCTGG - Intergenic
1052187734 9:25619788-25619810 GCAGGGTACAGCCCCACTCCTGG + Intergenic
1052250332 9:26390446-26390468 GCAGGGCACAGCCCCCCTCCAGG - Intergenic
1052614570 9:30821539-30821561 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1052689760 9:31802278-31802300 GCAGGGTACAGCCCCCTTCCTGG - Intergenic
1053720940 9:40946148-40946170 GCAGGGTACAGCCCTCCTCCTGG + Intergenic
1053746124 9:41199504-41199526 GCAGGGTACAGCCTCTCTCCAGG + Intergenic
1053793487 9:41703840-41703862 GCAGGGTATAGCCCACCTCGTGG - Intergenic
1054181898 9:61915855-61915877 GCAGGGTATAGCCCACCTCGTGG - Intergenic
1054345052 9:63906008-63906030 GCAGGGTACAGCCCTCCTCCTGG - Intergenic
1054471459 9:65542129-65542151 GCAGGGTATAGCCCACCTCGTGG + Intergenic
1054481146 9:65665713-65665735 GCAGGGTACAGCCTCTCTCCAGG - Intergenic
1054682221 9:68231776-68231798 GCAGGGTACAGCCTCTCTCCAGG - Intergenic
1055080759 9:72265895-72265917 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1055142041 9:72887054-72887076 GCAGGGTATAGCTCCCCTCCTGG - Intergenic
1055174298 9:73298913-73298935 GCTGGGTATAGCCCCCCTCCTGG + Intergenic
1055384682 9:75748128-75748150 GCAGGGTACAGCCTCCCTCCAGG - Intergenic
1055413149 9:76053062-76053084 GCAGGGTACAGCGCCCCTCCTGG + Intronic
1055713285 9:79088742-79088764 GCAGGGTATAGGCCCCCTCCTGG + Intergenic
1056639444 9:88357983-88358005 GCAGGGTATAGCCTCCTTCCTGG - Intergenic
1056786014 9:89593050-89593072 GCCTGGTAGAGCCCCACTCCAGG - Intergenic
1057004772 9:91547470-91547492 GCAAGGTATTGCCACTTACCTGG + Intergenic
1058004521 9:99901526-99901548 GCAGGGTATACCACCCCTCCTGG + Intergenic
1058082177 9:100712172-100712194 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1058149970 9:101453014-101453036 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1058240248 9:102548604-102548626 ACAGGGTACAGCCCCACTCCTGG - Intergenic
1058245889 9:102625190-102625212 GCAGGGTACAGCCCCCCTCCCGG + Intergenic
1058810069 9:108630714-108630736 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1059045530 9:110862049-110862071 GCAGGGTATAGCTCCCCTCCTGG - Intergenic
1059195461 9:112366880-112366902 ACAGGGTATAGCCCCCCTCCTGG - Intergenic
1059582623 9:115567823-115567845 GTAGGGTATAGTCCCCCTCCTGG - Intergenic
1059684160 9:116618620-116618642 GCAAGTTATTTCCCCTCTCATGG + Intronic
1060449436 9:123723020-123723042 GCAGGGTACAGCCACCCTCCTGG - Intronic
1060569022 9:124620884-124620906 GCAAGTTAAAGCCCCTCCCAAGG - Intronic
1060653572 9:125352082-125352104 GCAGGGTATAGCCACTTTTCTGG + Intronic
1061646644 9:132008294-132008316 ATAAGATATAGCCACTCTCCAGG + Intronic
1062099868 9:134722447-134722469 GCAAGGTATGGCCGCTGTGCTGG + Intronic
1202782254 9_KI270718v1_random:10277-10299 GCAGGGTACAGCCTCTCTCCAGG + Intergenic
1186221839 X:7357100-7357122 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1186266581 X:7840335-7840357 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1186700353 X:12083657-12083679 GCAGGGTACAGCCTCTCTCCTGG - Intergenic
1186742667 X:12534521-12534543 GCAGGGCACAGCCTCTCTCCTGG - Intronic
1186857301 X:13638469-13638491 TAAAGGTACAACCCCTCTCCAGG - Intergenic
1186954685 X:14669253-14669275 GCAAGGTACAGCCTCCCTCCTGG + Intronic
1187002731 X:15199449-15199471 TCAGGGTACAGCCCCCCTCCTGG + Intergenic
1187796138 X:23006342-23006364 GCAGAGTATACCCCCTCTCCCGG + Intergenic
1188018834 X:25134945-25134967 GCAGGGTACAGCCCCACTCCTGG - Intergenic
1188055996 X:25541789-25541811 GCAGGGTACAGCCCCCCTTCTGG + Intergenic
1188114948 X:26231631-26231653 GCAGGGTATAGCTCCCCTCTTGG + Intergenic
1188127160 X:26383530-26383552 CCAGGGTTCAGCCCCTCTCCTGG - Intergenic
1188134950 X:26483786-26483808 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1188187255 X:27130533-27130555 GCAGGGTACAGCTCTTCTCCTGG + Intergenic
1188196454 X:27240721-27240743 GCAGGGTGTAGCCCCACTCCTGG - Intergenic
1188457203 X:30380151-30380173 GCAGGGTATAGCCCACCTCCTGG - Intergenic
1188580362 X:31704350-31704372 CCAAGGTATTGTCTCTCTCCAGG - Intronic
1188616563 X:32165266-32165288 GCAGGGTAGAGCCCCTCTCCTGG - Intronic
1188624371 X:32265597-32265619 GCAGGGTACAGCCCCCTTCCTGG - Intronic
1188785038 X:34335863-34335885 GCAGGGTATAGCCCCCCTCCTGG + Intergenic
1188794159 X:34441773-34441795 GCAGGGTATAGCCCCCCTCCTGG + Intergenic
1188863387 X:35285394-35285416 GCAGGATATAGCCCCACTCCTGG + Intergenic
1188865217 X:35305731-35305753 GCAAGGTACAGCCCCACTTCAGG - Intergenic
1188961837 X:36502126-36502148 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
1189028780 X:37428593-37428615 GCAGGGTACAGCCTCGCTCCTGG + Intronic
1189087954 X:38047032-38047054 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1189228739 X:39435445-39435467 GCAGGGTACAGCCTCTCTCCTGG + Intergenic
1189352888 X:40290155-40290177 GCATGTGATAGCCCATCTCCAGG - Intergenic
1189604284 X:42660131-42660153 GCAGGGTACAGCTCCCCTCCTGG - Intergenic
1189669696 X:43394949-43394971 GCAGGGTGTAGCCCTCCTCCTGG + Intergenic
1189815828 X:44823348-44823370 GCAGGGTACAGCTCCCCTCCTGG - Intergenic
1189896211 X:45659055-45659077 GCGGGGTATAGCCCCCCTCCAGG - Intergenic
1191188626 X:57640521-57640543 GCAGGGTATAGCCTCCCTTCTGG - Intergenic
1191211409 X:57889103-57889125 GCAGGGCACAGCCCCACTCCTGG + Intergenic
1191602645 X:63026755-63026777 GCAGGGTACAGCTCCCCTCCTGG + Intergenic
1191607879 X:63081555-63081577 GCAGGGTATGGCCCTCCTCCTGG - Intergenic
1191674204 X:63777874-63777896 GCAGGGTACAGTCCCCCTCCAGG + Intronic
1191856070 X:65628063-65628085 GCAGGGTACAGCCTCCCTCCTGG + Intronic
1192004758 X:67198529-67198551 TCAAGGTCATGCCCCTCTCCAGG - Intergenic
1192169177 X:68843872-68843894 GCAAGTTACAGCCCCTCACAGGG - Intergenic
1192335670 X:70217282-70217304 GCAAGGTACAGCTCTCCTCCTGG - Intergenic
1192856491 X:75017933-75017955 GCAGGGTACAACCTCTCTCCTGG + Intergenic
1193153498 X:78148470-78148492 GCAGGGTATAGCCTCCCTCCTGG - Intergenic
1193195956 X:78631777-78631799 GCTGGGTACAGCCCCCCTCCTGG - Intergenic
1193226503 X:78990027-78990049 GCAAGGTTCAGCCTCCCTCCTGG - Intergenic
1193439035 X:81515897-81515919 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1193497426 X:82231914-82231936 GCAGGGTATAGCCTCTCTCCTGG - Intergenic
1193503508 X:82309912-82309934 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1193682740 X:84541762-84541784 GCAGGGTACAGTCCCCCTCCTGG - Intergenic
1193682784 X:84542007-84542029 GCAGGGTACAGTCCCCCTCCTGG - Intergenic
1193808062 X:86016892-86016914 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1193813683 X:86081682-86081704 GCAGAGTATATCCCCCCTCCTGG + Intergenic
1193816150 X:86107191-86107213 GCAAGGTACAGCTCCACTCCTGG + Intergenic
1193857794 X:86626349-86626371 ACAGGGTATAGCCCCACTCCTGG + Intronic
1193918802 X:87400486-87400508 GCAGGGTGTAGCCTCCCTCCCGG - Intergenic
1193943871 X:87708636-87708658 GCAGGGTACAGCCCCCATCCTGG + Intergenic
1193962906 X:87947573-87947595 GCAGCGTGTAGCCCCACTCCTGG - Intergenic
1194125670 X:90013054-90013076 GCAGGGTACAGCCCCCTTCCTGG - Intergenic
1194215741 X:91128662-91128684 GCAGGGTATAGCCTCCCTCCTGG + Intergenic
1194252912 X:91600307-91600329 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
1194274061 X:91857784-91857806 GCAGGGTACAGCCCCTCTCCTGG + Intronic
1194330995 X:92582772-92582794 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1194496287 X:94621058-94621080 GCAGGGTACAGCCTTTCTCCTGG + Intergenic
1194507127 X:94746235-94746257 GCAAGGTACAGACCCCCTCCTGG - Intergenic
1194566474 X:95494706-95494728 GCAGGGTATAGCCTCCCTCCTGG - Intergenic
1194662173 X:96639467-96639489 GCAAGGTACAGCCTCCCTCCTGG - Intergenic
1194843665 X:98776382-98776404 GCAGGGTACAGCCCTCCTCCTGG - Intergenic
1194877014 X:99201542-99201564 GCAGGGTACAGCCTCACTCCTGG - Intergenic
1194929462 X:99868236-99868258 GCAGGGTACAGCTCCCCTCCTGG - Intergenic
1194941551 X:100016605-100016627 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1195126691 X:101815213-101815235 GCAGGGTATAGCCCCTCTCCTGG + Intergenic
1195210034 X:102645857-102645879 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1195428539 X:104762414-104762436 GCAGGGTACAGCCCCTCTCCTGG + Intronic
1195554805 X:106210148-106210170 GCAGGGTATAACCTCCCTCCTGG + Intergenic
1195608303 X:106834880-106834902 GCAGGGTACAGCCCCCCTCCTGG + Intronic
1195819609 X:108930171-108930193 GCAGGGTACAGCCCCCTTCCTGG + Intergenic
1195823605 X:108973056-108973078 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1195838883 X:109150367-109150389 GCAGGGTACAGACCCCCTCCTGG - Intergenic
1196285255 X:113871905-113871927 GCAGGGTACAACCCCCCTCCTGG - Intergenic
1196313450 X:114196303-114196325 GCAGGGTACATTCCCTCTCCTGG + Intergenic
1196379911 X:115078171-115078193 ACAGGGTAAAACCCCTCTCCTGG - Intergenic
1196391394 X:115210738-115210760 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1196522263 X:116687450-116687472 GCAGGGTATAGCCCCCTTCCTGG - Intergenic
1196565269 X:117197183-117197205 GCAGGGTACAGCCCATCTCCTGG - Intergenic
1196576273 X:117322793-117322815 GCAGGGTACAGCCCCCCTCCTGG - Intergenic
1196605604 X:117654208-117654230 GCAGGGTACAGCTCCTCTCCTGG + Intergenic
1196973828 X:121137655-121137677 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1197016511 X:121632319-121632341 GCAGGCTATAGCCCCCCTCTTGG + Intergenic
1197088626 X:122509996-122510018 GCAGGGTACAGCCCCGCTCCTGG + Intergenic
1197202381 X:123759426-123759448 ACAGGGTATGGCCCCGCTCCCGG - Intergenic
1197301648 X:124788760-124788782 ACAGGGTATAGCCCCCCTCATGG + Intronic
1197368840 X:125600802-125600824 GCAGGGTACAGCCCCCATCCTGG - Intergenic
1197379479 X:125721971-125721993 GCAGGGTATAGCCCGCCTCCTGG - Intergenic
1197400046 X:125979161-125979183 GCAGGATATAGCCCCTCTCCTGG + Intergenic
1197451832 X:126628969-126628991 GCAGGGTACAGCTCCACTCCTGG + Intergenic
1197642936 X:128986431-128986453 GCAGGGTATAGCCCCCCTTCTGG - Intergenic
1197856540 X:130919306-130919328 GCAGGGTACAGCCTCCCTCCCGG + Intergenic
1197911033 X:131482728-131482750 GCAGGGTATAGCCCACCTCCTGG - Intergenic
1198734668 X:139772540-139772562 GCAGGGTATAGTCTCCCTCCTGG - Intronic
1198804016 X:140475694-140475716 GCAGGGTATAGTCCCACTTCTGG - Intergenic
1198836045 X:140805826-140805848 GCAGGGTACAGCTCCCCTCCTGG + Intergenic
1198857560 X:141033787-141033809 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1198888132 X:141361905-141361927 GCAGGGTATATCCCCCCTCCTGG + Intergenic
1198905137 X:141553584-141553606 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1198941678 X:141963698-141963720 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
1198990972 X:142514710-142514732 GCAGGGTACAGCCTCCCTCCTGG + Intergenic
1199020375 X:142870897-142870919 GCAGGACATAGCCCCTCTCCTGG - Intergenic
1199027836 X:142960909-142960931 GCAAGGTACAGCTCCCCTCCTGG + Intergenic
1199071215 X:143477346-143477368 TCATGGTACAGCCCCCCTCCTGG - Intergenic
1199106634 X:143876105-143876127 GCAGGGTATGGCCTCCCTCCTGG - Intergenic
1199127351 X:144138851-144138873 GCAGGATACAGCCCCCCTCCTGG + Intergenic
1199132514 X:144208320-144208342 GCAGGGTACAGACTCTCTCCTGG - Intergenic
1199147107 X:144381131-144381153 GCAGGGTACAGCCCTCCTCCTGG - Intergenic
1199157963 X:144572333-144572355 GCAGGGTGTAGCCCATCTTCTGG - Intergenic
1199301673 X:146220853-146220875 GCAGGGTACAGCCCCCCTGCTGG + Intergenic
1199327211 X:146513324-146513346 GCAAGGTATAGCCTCCCTCCTGG - Intergenic
1199420398 X:147637466-147637488 GCAGGGTACAGCCCCCCTCGTGG - Intergenic
1199462707 X:148101560-148101582 GCAGGATATAGCCCTCCTCCCGG - Intergenic
1199515207 X:148668246-148668268 GCAGGGCGTAGCCCCCCTCCTGG + Intronic
1199929724 X:152506228-152506250 GCAGGGTACTGCCCCTCTCCTGG + Intergenic
1200295316 X:154913777-154913799 GCAGGGTACAGCCCTGCTCCTGG + Intronic
1200332272 X:155310514-155310536 GCAGGGTACAGCCTCTCTCCTGG + Intronic
1200342154 X:155409101-155409123 GCAGTGTATAGCTCCCCTCCTGG - Intergenic
1200345244 X:155440992-155441014 GCAGGGTACAGCCCCCTTCCTGG + Intergenic
1200381630 X:155843209-155843231 GCAGGGTATAGCCTCCCTTCTGG - Intergenic
1200571849 Y:4841547-4841569 GCAGGGTACAGCCCCCCTCCTGG + Intergenic
1200591295 Y:5079195-5079217 GCAGGGTACAGCCCCTCTCCTGG + Intronic
1200639697 Y:5701839-5701861 GCAGGGTACAGCCTCCCTCCTGG - Intronic
1201020585 Y:9652488-9652510 GGAAGCTATAGCCTCTGTCCAGG + Intergenic
1201589976 Y:15604142-15604164 GCAGGGTACAGCCCCTGTCTTGG + Intergenic
1201592400 Y:15629317-15629339 ACAGGGTACAGCCACTCTCCTGG - Intergenic
1202019858 Y:20453017-20453039 GCAGGGTACAGCCTCCCTCCTGG - Intergenic
1202114055 Y:21453139-21453161 GGAAGCTATAGCCTCTGTCCAGG - Intergenic