ID: 1179764847

View in Genome Browser
Species Human (GRCh38)
Location 21:43564454-43564476
Sequence CCCTCTCCTGGCTGCTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2430
Summary {0: 30, 1: 166, 2: 534, 3: 723, 4: 977}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179764842_1179764847 1 Left 1179764842 21:43564430-43564452 CCCTGTGGCTTTGCAAGGTATAG 0: 11
1: 269
2: 1293
3: 1607
4: 1336
Right 1179764847 21:43564454-43564476 CCCTCTCCTGGCTGCTTTCATGG 0: 30
1: 166
2: 534
3: 723
4: 977
1179764841_1179764847 2 Left 1179764841 21:43564429-43564451 CCCCTGTGGCTTTGCAAGGTATA 0: 11
1: 275
2: 1339
3: 1508
4: 1309
Right 1179764847 21:43564454-43564476 CCCTCTCCTGGCTGCTTTCATGG 0: 30
1: 166
2: 534
3: 723
4: 977
1179764836_1179764847 23 Left 1179764836 21:43564408-43564430 CCATGGCCTTGGGTAGCTCCACC 0: 7
1: 120
2: 603
3: 1174
4: 1697
Right 1179764847 21:43564454-43564476 CCCTCTCCTGGCTGCTTTCATGG 0: 30
1: 166
2: 534
3: 723
4: 977
1179764835_1179764847 24 Left 1179764835 21:43564407-43564429 CCCATGGCCTTGGGTAGCTCCAC 0: 3
1: 136
2: 678
3: 1178
4: 1776
Right 1179764847 21:43564454-43564476 CCCTCTCCTGGCTGCTTTCATGG 0: 30
1: 166
2: 534
3: 723
4: 977
1179764837_1179764847 17 Left 1179764837 21:43564414-43564436 CCTTGGGTAGCTCCACCCCTGTG 0: 10
1: 228
2: 487
3: 783
4: 1083
Right 1179764847 21:43564454-43564476 CCCTCTCCTGGCTGCTTTCATGG 0: 30
1: 166
2: 534
3: 723
4: 977
1179764840_1179764847 5 Left 1179764840 21:43564426-43564448 CCACCCCTGTGGCTTTGCAAGGT 0: 32
1: 563
2: 853
3: 879
4: 758
Right 1179764847 21:43564454-43564476 CCCTCTCCTGGCTGCTTTCATGG 0: 30
1: 166
2: 534
3: 723
4: 977
1179764843_1179764847 0 Left 1179764843 21:43564431-43564453 CCTGTGGCTTTGCAAGGTATAGC 0: 12
1: 255
2: 1290
3: 1715
4: 1489
Right 1179764847 21:43564454-43564476 CCCTCTCCTGGCTGCTTTCATGG 0: 30
1: 166
2: 534
3: 723
4: 977

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179764847 Original CRISPR CCCTCTCCTGGCTGCTTTCA TGG Intronic
Too many off-targets to display for this crispr