ID: 1179764849

View in Genome Browser
Species Human (GRCh38)
Location 21:43564455-43564477
Sequence CCTCTCCTGGCTGCTTTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3201
Summary {0: 28, 1: 201, 2: 627, 3: 1035, 4: 1310}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179764835_1179764849 25 Left 1179764835 21:43564407-43564429 CCCATGGCCTTGGGTAGCTCCAC 0: 3
1: 136
2: 678
3: 1178
4: 1776
Right 1179764849 21:43564455-43564477 CCTCTCCTGGCTGCTTTCATGGG 0: 28
1: 201
2: 627
3: 1035
4: 1310
1179764840_1179764849 6 Left 1179764840 21:43564426-43564448 CCACCCCTGTGGCTTTGCAAGGT 0: 32
1: 563
2: 853
3: 879
4: 758
Right 1179764849 21:43564455-43564477 CCTCTCCTGGCTGCTTTCATGGG 0: 28
1: 201
2: 627
3: 1035
4: 1310
1179764843_1179764849 1 Left 1179764843 21:43564431-43564453 CCTGTGGCTTTGCAAGGTATAGC 0: 12
1: 255
2: 1290
3: 1715
4: 1489
Right 1179764849 21:43564455-43564477 CCTCTCCTGGCTGCTTTCATGGG 0: 28
1: 201
2: 627
3: 1035
4: 1310
1179764842_1179764849 2 Left 1179764842 21:43564430-43564452 CCCTGTGGCTTTGCAAGGTATAG 0: 11
1: 269
2: 1293
3: 1607
4: 1336
Right 1179764849 21:43564455-43564477 CCTCTCCTGGCTGCTTTCATGGG 0: 28
1: 201
2: 627
3: 1035
4: 1310
1179764841_1179764849 3 Left 1179764841 21:43564429-43564451 CCCCTGTGGCTTTGCAAGGTATA 0: 11
1: 275
2: 1339
3: 1508
4: 1309
Right 1179764849 21:43564455-43564477 CCTCTCCTGGCTGCTTTCATGGG 0: 28
1: 201
2: 627
3: 1035
4: 1310
1179764837_1179764849 18 Left 1179764837 21:43564414-43564436 CCTTGGGTAGCTCCACCCCTGTG 0: 10
1: 228
2: 487
3: 783
4: 1083
Right 1179764849 21:43564455-43564477 CCTCTCCTGGCTGCTTTCATGGG 0: 28
1: 201
2: 627
3: 1035
4: 1310
1179764836_1179764849 24 Left 1179764836 21:43564408-43564430 CCATGGCCTTGGGTAGCTCCACC 0: 7
1: 120
2: 603
3: 1174
4: 1697
Right 1179764849 21:43564455-43564477 CCTCTCCTGGCTGCTTTCATGGG 0: 28
1: 201
2: 627
3: 1035
4: 1310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179764849 Original CRISPR CCTCTCCTGGCTGCTTTCAT GGG Intronic
Too many off-targets to display for this crispr