ID: 1179764852

View in Genome Browser
Species Human (GRCh38)
Location 21:43564467-43564489
Sequence GCTTTCATGGGCTGGCATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 14, 1: 11, 2: 25, 3: 36, 4: 194}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179764846_1179764852 -10 Left 1179764846 21:43564454-43564476 CCCTCTCCTGGCTGCTTTCATGG 0: 32
1: 168
2: 288
3: 474
4: 796
Right 1179764852 21:43564467-43564489 GCTTTCATGGGCTGGCATTGAGG 0: 14
1: 11
2: 25
3: 36
4: 194
1179764843_1179764852 13 Left 1179764843 21:43564431-43564453 CCTGTGGCTTTGCAAGGTATAGC 0: 12
1: 255
2: 1290
3: 1715
4: 1489
Right 1179764852 21:43564467-43564489 GCTTTCATGGGCTGGCATTGAGG 0: 14
1: 11
2: 25
3: 36
4: 194
1179764845_1179764852 -9 Left 1179764845 21:43564453-43564475 CCCCTCTCCTGGCTGCTTTCATG 0: 38
1: 290
2: 583
3: 892
4: 1287
Right 1179764852 21:43564467-43564489 GCTTTCATGGGCTGGCATTGAGG 0: 14
1: 11
2: 25
3: 36
4: 194
1179764840_1179764852 18 Left 1179764840 21:43564426-43564448 CCACCCCTGTGGCTTTGCAAGGT 0: 32
1: 563
2: 853
3: 879
4: 758
Right 1179764852 21:43564467-43564489 GCTTTCATGGGCTGGCATTGAGG 0: 14
1: 11
2: 25
3: 36
4: 194
1179764842_1179764852 14 Left 1179764842 21:43564430-43564452 CCCTGTGGCTTTGCAAGGTATAG 0: 11
1: 269
2: 1293
3: 1607
4: 1336
Right 1179764852 21:43564467-43564489 GCTTTCATGGGCTGGCATTGAGG 0: 14
1: 11
2: 25
3: 36
4: 194
1179764841_1179764852 15 Left 1179764841 21:43564429-43564451 CCCCTGTGGCTTTGCAAGGTATA 0: 11
1: 275
2: 1339
3: 1508
4: 1309
Right 1179764852 21:43564467-43564489 GCTTTCATGGGCTGGCATTGAGG 0: 14
1: 11
2: 25
3: 36
4: 194
1179764837_1179764852 30 Left 1179764837 21:43564414-43564436 CCTTGGGTAGCTCCACCCCTGTG 0: 10
1: 228
2: 487
3: 783
4: 1083
Right 1179764852 21:43564467-43564489 GCTTTCATGGGCTGGCATTGAGG 0: 14
1: 11
2: 25
3: 36
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179764852 Original CRISPR GCTTTCATGGGCTGGCATTG AGG Intronic
901150379 1:7097286-7097308 GCTTTGATGGGGTGGAGTTGGGG + Intronic
902504276 1:16929439-16929461 GCTTTCCTGAGCTCACATTGGGG + Intronic
903297719 1:22355773-22355795 GCTTTAAAAGGCTGGCTTTGGGG + Intergenic
904053712 1:27656547-27656569 GCTTTATAGGGCTGGCATGGGGG + Intergenic
905808423 1:40893906-40893928 GCTTTTAAAGGCTGGCATTGAGG + Intergenic
912070261 1:105800748-105800770 GTTTTCATGGGCAGGCATTGAGG + Intergenic
912096449 1:106150257-106150279 ACTTTCACAGGCTGTCATTGAGG - Intergenic
913336982 1:117717520-117717542 GCTTTCATGGCCTGGTGTTGAGG - Intergenic
915126335 1:153667781-153667803 GCTTTCATGTGGTGGTTTTGGGG - Intronic
915171868 1:153983596-153983618 GTTTTCATGGGATGGAATAGAGG + Intronic
915216203 1:154342259-154342281 TCTTTCATGGCCAGGCCTTGGGG + Intronic
916095549 1:161346683-161346705 GCTATCATGGCCGGGCATGGTGG - Intronic
916863454 1:168831587-168831609 GCTTTCATGTGCTGACGATGGGG - Intergenic
917371891 1:174301715-174301737 GCTTTTATGGGCTCAGATTGGGG + Intronic
917824967 1:178809666-178809688 GCTTTAATGGACTGTCATTTGGG + Intronic
917967726 1:180189052-180189074 GATTCCATGGGCTGCCAGTGAGG - Intronic
918027451 1:180765312-180765334 GATTAGATTGGCTGGCATTGAGG - Intronic
919743653 1:200995272-200995294 GCTGTGAAGGGCTGGCCTTGGGG - Intronic
920941017 1:210482558-210482580 GCTTTCAAGGGCTGGGATCACGG - Intronic
922781817 1:228258452-228258474 GCTGTCATGGGTTGGCATTTGGG - Intronic
1062884122 10:1003928-1003950 CCTATCATGGCCTGGCCTTGGGG + Intronic
1066565758 10:36719996-36720018 CCTTTCCTGGCCTGGCATGGTGG - Intergenic
1067306668 10:45071056-45071078 GCTGGCATGGGAGGGCATTGTGG - Intergenic
1069820415 10:71224121-71224143 GCTTTCCTGGGCTGCCAGGGAGG - Intronic
1070473919 10:76813656-76813678 ACTGTGATGGGCTGCCATTGGGG + Intergenic
1070537703 10:77392080-77392102 GCTTTCATGGGTTGGGAAGGAGG + Intronic
1070560667 10:77564283-77564305 GATTTCATGGCCAGGCATGGTGG + Intronic
1071720396 10:88138011-88138033 GCTTTCTTGGGCTGGACTTCTGG + Intergenic
1072350071 10:94548704-94548726 GTTTTCATGGCCTGGCATGGTGG + Intronic
1072769334 10:98124614-98124636 GCTTTCATGGGCTGGCATTGAGG + Intergenic
1072853511 10:98922624-98922646 GCTTTCATGGGCACCAATTGGGG + Intronic
1073010213 10:100353243-100353265 CCTTTCTTGGGCTGCCATGGTGG + Intronic
1075204541 10:120435611-120435633 GGTTTCAGGGGGTGGGATTGGGG + Intergenic
1075792794 10:125097489-125097511 GCTTCCTTGGGTTGGCTTTGAGG - Intronic
1077199934 11:1301659-1301681 GCCTCCGTGGGCTGGCTTTGTGG - Intronic
1078056467 11:8013205-8013227 GCTTGCTTGGCCTGGCATGGTGG + Intergenic
1079713773 11:23718740-23718762 GCTTTCACAAGCTGGCATTGAGG - Intergenic
1081008102 11:37773757-37773779 GCTTTCACAGGCTGGCATTGAGG + Intergenic
1081316500 11:41637300-41637322 GCTTTCACGAGCTGGCATTGAGG + Intergenic
1081715126 11:45244637-45244659 GCTTTCATTTCCTTGCATTGGGG + Intronic
1083710884 11:64547576-64547598 TCTTTCCTGGTCTGGCCTTGGGG + Intergenic
1084824850 11:71722292-71722314 GCTTACCTGGGATGGCAGTGAGG - Intergenic
1085232181 11:74981788-74981810 CCTTTCATGGGCTGGATTAGGGG + Intergenic
1085280241 11:75325287-75325309 CCTTTTTTGGGCTGGCATTCTGG - Intronic
1088206270 11:107396704-107396726 GCATGCAGGGGCTTGCATTGTGG + Intronic
1089497108 11:118913491-118913513 GCAATCATGGCCTGGCAGTGGGG + Intronic
1089533724 11:119148705-119148727 TCATTCATGGGCTGGAACTGAGG + Intergenic
1092193567 12:6536163-6536185 GCATTCCTGGGGTGGCATAGTGG + Intronic
1094126153 12:27023931-27023953 GCTTTCATACACTGGCAGTGTGG + Intronic
1094168218 12:27464332-27464354 GCATTCAGGGGCTGGCAGAGTGG + Intergenic
1096584685 12:52612182-52612204 GCTTTCCAGGGCTGGGATGGAGG + Intronic
1096904970 12:54926923-54926945 GCTTTCATGGGCTGGCATTGAGG - Intergenic
1097481075 12:60126541-60126563 GCTTTCATGGGCTGGCATTGAGG - Intergenic
1099536862 12:83855987-83856009 GCTTTCATGGGATGGCATTAAGG - Intergenic
1101187082 12:102291151-102291173 GCGTTCACGGGCTGGCATTGAGG - Intergenic
1103881645 12:124170860-124170882 GCGTTCATGGGCTGGATCTGGGG - Intronic
1105322996 13:19345654-19345676 GTCTCCATGGGCTGGGATTGGGG - Intergenic
1105604433 13:21915132-21915154 GCTTGCATGGGCAGCCATGGAGG - Intergenic
1106939965 13:34767584-34767606 GCTTTAACAGGCTGGCATGGTGG + Intergenic
1111239709 13:85457986-85458008 GCTTTCATGGGCTGGCATTGAGG - Intergenic
1112474329 13:99717136-99717158 TGTTTCTTGGGCTGGCATGGTGG + Intronic
1113284977 13:108836569-108836591 GCTTTCATGGGCTGGCATTGAGG - Intronic
1113466773 13:110518650-110518672 GTTTTCTTGGGATGTCATTGTGG - Intergenic
1113628228 13:111862271-111862293 GGTTGCCTGGGCTGGTATTGAGG - Intergenic
1113892134 13:113742048-113742070 GCATTCTTCGGCTGGCCTTGTGG + Intergenic
1114217097 14:20665181-20665203 GCTTTCCTGGGCTGGCCTTGAGG + Intergenic
1115340787 14:32291300-32291322 GCTTTCAAAGGCTGGCATTGAGG - Intergenic
1115370966 14:32614607-32614629 GCTTTATTTGGCAGGCATTGTGG + Intronic
1116349453 14:43841660-43841682 GTTGTCATGGGCTGGGATTATGG - Intergenic
1117427867 14:55620258-55620280 GCTTTCATGGGCTGGCGTTGAGG + Intronic
1117886778 14:60372200-60372222 GCTCTCATGGGCTGGGATTGTGG - Intergenic
1119379326 14:74218567-74218589 GCTGGCATGGGCTGGCAGGGAGG - Intergenic
1119785962 14:77314568-77314590 GCCTCCATGGGCAGGCAATGGGG + Intronic
1120257845 14:82142140-82142162 GCTTTCACAGGCTGGCATTGAGG + Intergenic
1120258494 14:82151988-82152010 GCTTTTATGGGCTGGTTTTTTGG + Intergenic
1120557703 14:85949407-85949429 GCTCTCTTGGGCTGGCTGTGTGG + Intergenic
1123063659 14:105605725-105605747 GCCTTCATGTGCTCGCCTTGAGG - Intergenic
1123100972 14:105800489-105800511 GCTATCAAGGGCAGGCATGGTGG + Intergenic
1123119896 14:105911659-105911681 GATGTCATGGGCTGGCCTTGGGG + Intergenic
1123149598 14:106168124-106168146 GCTTTCACGAGCTGGCATTGAGG + Intergenic
1123480443 15:20626639-20626661 GCTTTCATCCCCTGACATTGTGG - Intergenic
1123637565 15:22373728-22373750 GCTTTCATCCCCTGACATTGTGG + Intergenic
1124025244 15:25959716-25959738 GCTTCCATGGGCTGGAAGAGTGG + Intergenic
1124509027 15:30306580-30306602 GCTTTCATGGGCTGGTGTTGAGG + Intergenic
1124734530 15:32232082-32232104 GCTTTCATGGGCTGGTGTTGAGG - Intergenic
1126097563 15:45100280-45100302 CCTTTCATGGAGTGGCATTAAGG - Intronic
1129247148 15:74286511-74286533 GGTTTCCTGGGCTGACCTTGTGG + Intronic
1131613423 15:93988677-93988699 GATTTTATGGCCTGGCATGGTGG + Intergenic
1132945773 16:2530806-2530828 GCTTTCCTGGGCTGCCCCTGGGG - Exonic
1133312114 16:4855325-4855347 GTTTTCTTGGCCTGGCATAGTGG + Intronic
1134197375 16:12169570-12169592 GCATTCATGGCCAGGCGTTGTGG + Intronic
1136750973 16:32635596-32635618 GCTTTCACGGGCAGGCACGGTGG - Intergenic
1138170099 16:54840833-54840855 TCTATCATGGGCTGGCAATGGGG + Intergenic
1203053107 16_KI270728v1_random:894852-894874 GCTTTCACGGGCAGGCACGGTGG - Intergenic
1143560561 17:7691810-7691832 TCTCTCATGGCCTGGCATGGTGG - Intronic
1144591708 17:16529783-16529805 TCTTTCTTGGTCAGGCATTGTGG + Intergenic
1146550340 17:33775368-33775390 GCCTTCATGGGCTGACACTCTGG + Intronic
1148374708 17:47132716-47132738 GCTTTAATGGCTAGGCATTGTGG - Intronic
1150065000 17:62101550-62101572 GCTTTTGTGGGCTGGCCTTGGGG - Intergenic
1150579800 17:66461961-66461983 GCTTCTATGGGATGTCATTGAGG + Intronic
1151202414 17:72478317-72478339 GCTTTCATGGGCAGGCACAGTGG + Intergenic
1151407145 17:73895805-73895827 ACTTTCAGGGGCCGGCACTGTGG - Intergenic
1153371211 18:4318100-4318122 GCTTTTATGGCCAGGCATGGTGG - Intronic
1156498180 18:37539864-37539886 GCTGTCATGGGCTTGCTGTGAGG + Intronic
1157932667 18:51840576-51840598 GCTTTGCTGGGCGGGCATGGTGG + Intergenic
1158504639 18:58035663-58035685 AGTTTCCTCGGCTGGCATTGTGG + Intergenic
1160215415 18:76924739-76924761 GCCTACCTGTGCTGGCATTGTGG + Intronic
1162590866 19:11590274-11590296 GTATTCATGGCCTGGCATGGTGG - Intronic
1164736779 19:30546910-30546932 ACTTACATTTGCTGGCATTGTGG - Intronic
1166220858 19:41363676-41363698 GCTTTCATGGGTTGGCAATTAGG - Intronic
1168184620 19:54691659-54691681 GCTTCCAGGGGCTGGGGTTGGGG + Intronic
1168349793 19:55669267-55669289 GCTTTCATGGGAAGGCATTTGGG + Intronic
1168449129 19:56449386-56449408 GCTATCTTGGCCTGGCATGGTGG + Intronic
925546016 2:5017574-5017596 GCTATCATGGGCTAGCATAAAGG + Intergenic
926520615 2:13908728-13908750 GTTTTCATGGGCTGTCACTCCGG + Intergenic
926913079 2:17869467-17869489 AGTTTCATGGGCTGGCAGGGAGG + Intergenic
927427469 2:22996852-22996874 GCTTTCTTGGGATGCCATTAGGG - Intergenic
927641141 2:24846276-24846298 GCTTTCATAGGCTGGCTTTGAGG - Intronic
927708498 2:25311344-25311366 GCTTTCATGGGCTGCTGTGGTGG + Intronic
928808953 2:35198571-35198593 GCTTTTATGGGCTGGCATTGAGG - Intergenic
929424603 2:41831206-41831228 GTTTTCATTTGGTGGCATTGTGG - Intergenic
929941712 2:46338915-46338937 GCTTTCATGGGGTGGGGGTGGGG + Intronic
929966403 2:46540717-46540739 GCATTCATGGGCTGACAGGGGGG + Intronic
931079491 2:58753151-58753173 GCTCTCACAGGCTGGCATTGAGG - Intergenic
932565202 2:72901798-72901820 GCTCTCCTGGGCTGACACTGAGG + Intergenic
933064133 2:77772805-77772827 GCTTTCATGGGCTGGCATTGAGG + Intergenic
935385178 2:102492147-102492169 GCTTTCATGGGCTGGTGTTGAGG + Intronic
936292301 2:111235608-111235630 GCTCTCCTGGGCTGTCATTTTGG - Intergenic
936409355 2:112241345-112241367 TCTTCCATGGGCTGGCATTTGGG + Intronic
937159537 2:119746996-119747018 GCGCTCCTGGGCTGGCATAGTGG - Intergenic
937527555 2:122789160-122789182 GCTTTCACAGGCTGGCATTGAGG - Intergenic
939796509 2:146651910-146651932 GTTTTCATGGGCTGGGAGTGCGG + Intergenic
941941353 2:171041680-171041702 GTTTTCATGGGCTGGGGTGGGGG - Intronic
943565308 2:189509713-189509735 GGTTTCATGGGCTGGGCCTGGGG + Intergenic
943565390 2:189510170-189510192 GCTTTCACTGGCTGGCTTTGAGG - Intergenic
945931041 2:215854971-215854993 GCTTTCATGGGTTAGAATTGAGG - Intergenic
946534084 2:220607678-220607700 TCCTTTATGGGCTGGCATTGAGG + Intergenic
946883105 2:224195786-224195808 GTTTTCACTGGCTGGCATTGGGG + Intergenic
947356757 2:229304195-229304217 GCTTCCAGGGGCTGGAGTTGGGG - Intergenic
947667683 2:231917579-231917601 GCTGTAATGGGCTTGCCTTGTGG - Intergenic
948393889 2:237630865-237630887 GCTTTCCCGGGCTGCCACTGTGG + Intronic
1170938518 20:20829881-20829903 GGTTTCATGGGCTGGGCTTAGGG + Intergenic
1176358666 21:5974083-5974105 GCTTTCATGGGCTGGCATTGAGG - Intergenic
1177238775 21:18428948-18428970 GCTTTCATGAGTTGGCATTCAGG - Intronic
1178145470 21:29734904-29734926 GCTTTCTTGGCCTGGCATGCAGG + Intronic
1178533226 21:33392460-33392482 GCTTTCCGGGGCTGGGATTCAGG - Intergenic
1179764852 21:43564467-43564489 GCTTTCATGGGCTGGCATTGAGG + Intronic
1181055727 22:20259737-20259759 GCTTTCATGAGCGGTCAATGTGG + Intronic
1182320638 22:29476751-29476773 GCTTTCTGGGGCTGGGGTTGGGG - Intergenic
1182341462 22:29624603-29624625 GTTGTCATGGGCTGGGAGTGTGG + Intronic
1183908673 22:41062237-41062259 GCATTCACGTGCTGGCAATGGGG - Intergenic
1184022157 22:41827999-41828021 GCTTTCTTGGGGTGGCAGGGAGG + Intergenic
949770312 3:7570621-7570643 GCTTTCATGGGCTGGCATTGAGG + Intronic
952678293 3:36060104-36060126 CCTTCCATGGGCTTGCATGGCGG + Intergenic
952812337 3:37415642-37415664 GCCTTCATGGGCTTACATTCTGG - Intronic
954720342 3:52556523-52556545 GCCTTCATGGGCTGTGGTTGAGG + Intronic
955182064 3:56682365-56682387 GCTTTCAGGGGCTGGGAGGGAGG + Intronic
957762126 3:84572423-84572445 GCTTTCACGGGCTGTCATTGAGG + Intergenic
959004815 3:101008348-101008370 GCTTTTATGGGCTGGTGTTGAGG + Intergenic
959202892 3:103271302-103271324 GTTTTCGTGGGCTGGCTTTGAGG + Intergenic
961249587 3:125489836-125489858 GCTTTCATGGCCGGGCACAGTGG + Intronic
962981856 3:140497911-140497933 GCTTCCCTTGGCTGGCGTTGGGG + Intronic
964897247 3:161613112-161613134 GCTTTCATGGGCTGGCATTGAGG - Intergenic
965143915 3:164872990-164873012 GCTTTATTGGCCTGGCATGGTGG - Intergenic
965275436 3:166676819-166676841 GCTTTCACAGGCTGACATTGAGG + Intergenic
968009680 3:195265861-195265883 GCATTTCTGGGCTGGCATGGGGG - Intronic
972014542 4:34226748-34226770 GCTTTCATGGGCTGCCATTGAGG - Intergenic
973078560 4:45961791-45961813 GCTTTCATGGGCTGGCACTGAGG + Intergenic
975367144 4:73542450-73542472 GCTTCCAAGGCCTGGCATAGGGG - Intergenic
976853464 4:89576104-89576126 GCTTTCATGGGCTGGCACTGAGG - Intergenic
976967262 4:91058454-91058476 GCTACCATGGTCTGGCACTGAGG + Intronic
977952790 4:102993497-102993519 GCTTTCACAGGCTGGCATTGAGG + Intronic
980646155 4:135644495-135644517 GCTTTTATGGGCTGGCCTTGAGG - Intergenic
981862950 4:149379358-149379380 GCTTTCATGGGCTGGCATGGAGG - Intergenic
983448831 4:167886287-167886309 GTTTTCATGGGCTAGGATGGGGG + Intergenic
983657450 4:170097935-170097957 GCTTTCACAGGCTGGTGTTGAGG + Intergenic
983785957 4:171729547-171729569 GCTTTCATGGACTAGCATTGAGG - Intergenic
984747909 4:183240922-183240944 GCTTTCAGGGGCCGGGAATGCGG - Intronic
986322568 5:6644846-6644868 GGTACCATGGGCTGGCATTTGGG - Intronic
988165946 5:27590249-27590271 GCATTCATGGGGTTGCTTTGTGG + Intergenic
989423157 5:41264309-41264331 ACTTCCCTGGGCAGGCATTGAGG + Intergenic
991051462 5:62277152-62277174 GCTTTCATTGGCTGCTATTTTGG - Intergenic
993873941 5:93284470-93284492 GCATACATGGCCTGGCATGGTGG + Intergenic
994530921 5:100969681-100969703 GCCTTCATGGGCTCAAATTGAGG + Intergenic
994580240 5:101632462-101632484 GCTTTCACAGGATGGCATTTAGG + Intergenic
995477635 5:112563828-112563850 GCTTTCACAGGCTGCCATTGAGG - Intergenic
995703545 5:114961754-114961776 GCTTTCACTGGCTGGCATTGAGG + Intergenic
996020186 5:118582541-118582563 GGTTTCGTGGTCTGGCATGGTGG + Intergenic
998296759 5:140977955-140977977 GTTTTCATGGGCGGAGATTGAGG - Intronic
998839094 5:146234155-146234177 GCTTTCCTGGCCAGGCATGGTGG - Intronic
999989436 5:157036053-157036075 TTTTTCTTGGCCTGGCATTGTGG + Intronic
1000216132 5:159158490-159158512 GCTTTCATCCCCTGACATTGTGG - Exonic
1001729074 5:173935263-173935285 GCTTTCATTGTCTGTCATTAAGG + Intronic
1001992529 5:176129849-176129871 GCTTTCATGGGCAGGCATGGTGG - Intronic
1002224344 5:177708286-177708308 TTTTTCATGGGCAGGCATGGTGG + Intronic
1003760234 6:9171925-9171947 GCTTTCATGGGCTTTCATAGGGG - Intergenic
1004288495 6:14345226-14345248 ACTCTCATGCGCTGGCATTCAGG + Intergenic
1007188997 6:39997658-39997680 GCTTTCATGGGCAGGGGTTCAGG + Intergenic
1008687093 6:53937704-53937726 CCTGTTATGTGCTGGCATTGTGG + Intronic
1009402471 6:63273854-63273876 GCCATCCTGGGGTGGCATTGTGG - Intergenic
1009527341 6:64764019-64764041 GCTTTCATGGTCTGGCATTGAGG + Intronic
1010581737 6:77607295-77607317 GTTTTCATGGGGTGGAATTGTGG + Intergenic
1010611073 6:77954175-77954197 GCTTTCATGGGCTGGCATTGAGG - Intergenic
1010650983 6:78455343-78455365 GCTTTCACAGGCTGGTGTTGTGG + Intergenic
1011041203 6:83032201-83032223 TCTTTCATGGGCTGGTGTTGAGG - Intronic
1011835119 6:91421753-91421775 GCTTTCATGGGCTGGGATTGAGG - Intergenic
1012281099 6:97328920-97328942 GCTTTCACAGGCTGGTATTGAGG - Intergenic
1015985957 6:138884151-138884173 GCTAACATTGGCTGGCATGGTGG - Intronic
1016456017 6:144231536-144231558 GCTTTCTTGGCCTGGCAAGGTGG - Intergenic
1018803231 6:167239199-167239221 GGTTTCATGGCGTGGCATAGAGG - Intergenic
1021962246 7:25884695-25884717 GATGTCATGGGGTGGCATAGGGG + Intergenic
1022049720 7:26654179-26654201 GCTTTCATAGTCTGGCAGTTGGG - Intergenic
1022862564 7:34383168-34383190 GCTTTCATGGGCTGGCATTGAGG - Intergenic
1023552742 7:41387547-41387569 GCCTCCATGGGCTGGCCCTGAGG + Intergenic
1024082364 7:45865888-45865910 GCTCCCATGGCGTGGCATTGGGG - Intergenic
1024462570 7:49673419-49673441 GTTGGCATGGGCTGGCATTTAGG - Intergenic
1027395234 7:77746983-77747005 GCTCTCAAGGGCTGGTATTGAGG + Intronic
1028249652 7:88526029-88526051 GCTTTCACAGGCTGGTGTTGAGG + Intergenic
1028359967 7:89955769-89955791 GCTTTCATGGACTGGCATGGAGG + Intergenic
1030225351 7:107144371-107144393 GCTTTCATGGCCAGGCACAGTGG - Intronic
1031315931 7:120257402-120257424 ACTTTCAAGGGATGGCATTGAGG - Intergenic
1033735210 7:144215170-144215192 GCTTTCACGGGCTGGCGTTTAGG - Intergenic
1033747846 7:144335799-144335821 GCTTTCACGGGCTGGCGTTTAGG + Intergenic
1034095865 7:148407248-148407270 GCATTCTTGGGCTGACATTTGGG + Intronic
1034742873 7:153494987-153495009 GGTTTCATGGGCTGGGATCAGGG + Intergenic
1035859046 8:3008438-3008460 GCTTTGAGAGGCTGGCCTTGCGG - Intronic
1036200840 8:6770695-6770717 GCATTCATGGTAGGGCATTGGGG - Intergenic
1040876678 8:52159686-52159708 TCTTTAATGAGCTGGCATTTTGG + Intronic
1041360584 8:57049447-57049469 GCTTTCATGGGCTCAGAATGGGG - Intergenic
1041994841 8:64041938-64041960 TCTTTCATGGTATGGCACTGGGG - Intergenic
1042466304 8:69133175-69133197 GCTTTCATGGTCTGGTGTTGAGG + Intergenic
1042825639 8:72976391-72976413 GATTCCATGGGCTGACAATGTGG - Intergenic
1043478754 8:80631471-80631493 GCTTTCATGCTCTGTAATTGTGG + Exonic
1044247369 8:89964824-89964846 GCTTTTATGGCCAGGCATGGTGG + Intronic
1044414845 8:91926013-91926035 GCTTTCATGGGCTCAGAATGGGG - Intergenic
1045532135 8:102995065-102995087 GCTTTGATGGGCTGACATTGTGG - Intergenic
1045794789 8:106029980-106030002 TCTTTCATGGGGTGGGGTTGGGG + Intergenic
1046034284 8:108822027-108822049 GCTCTCATGGGCTGATGTTGAGG - Intergenic
1046368704 8:113271824-113271846 GCTTTCACTGGCTGGCATTGAGG - Intronic
1046917448 8:119692380-119692402 GCTTTCATGGGCTGGCATTGAGG - Intergenic
1048827501 8:138443145-138443167 GCTTTTATGGCCTGGCATCAGGG - Intronic
1050039716 9:1476336-1476358 TCTATCATTGGCTGGCATTTAGG + Intergenic
1051089113 9:13385477-13385499 ACTTTCATGGGCTGGCATCAAGG - Intergenic
1051334246 9:16052294-16052316 GTCATCATGGGCTGTCATTGTGG + Intronic
1051561104 9:18441149-18441171 GCTATCAGGGGCTGGGAGTGGGG + Intergenic
1052158642 9:25226938-25226960 GCTTTCATGGGCTAAGAATGGGG + Intergenic
1052518140 9:29510016-29510038 GCTTTCACAGGGTGCCATTGAGG + Intergenic
1053536247 9:38929182-38929204 GTTTTCATGGCCTGTCATTGTGG - Intergenic
1054629888 9:67434766-67434788 GTTTTCATGGCCTGTCATTGTGG + Intergenic
1055527185 9:77146777-77146799 ACGTTCATGGACTGGCATTTGGG - Intergenic
1057703073 9:97377585-97377607 GCTTTCAGGGGCTGGAAATTTGG - Intronic
1057799645 9:98182516-98182538 GCATTTCTGAGCTGGCATTGTGG + Intronic
1058288601 9:103210189-103210211 GGTTTCATGGGCTGGGCCTGGGG - Intergenic
1058513981 9:105751293-105751315 GCTTCCCTTGGCTGGCAATGGGG - Intronic
1059218283 9:112587794-112587816 CCTTTGAAGAGCTGGCATTGGGG - Intronic
1060521551 9:124296896-124296918 GCTGTAATGGGCTGGCTCTGAGG - Intronic
1061592568 9:131607419-131607441 GCCTTCCTGGGATGGCAGTGGGG + Intronic
1185524896 X:770085-770107 GCTGTGCTGGGCTGGCAGTGCGG + Intergenic
1185544244 X:929450-929472 GATTGCATGGGCTGGCACAGTGG - Intergenic
1185917874 X:4056425-4056447 CCTTTCAGGGGCTGGAATTCAGG - Intergenic
1187097167 X:16161355-16161377 GCTTTCACAGGCTGGTGTTGAGG + Intergenic
1188052932 X:25509218-25509240 GCTTTCATGGGCAGGCATTGAGG + Intergenic
1188926582 X:36051316-36051338 GCTTTCATGGGCTGGCATTGAGG - Intronic
1191710945 X:64149534-64149556 GCTTTCACTGGCCAGCATTGAGG + Intergenic
1192101876 X:68273121-68273143 ACTTTCATGGCCAGGCATGGTGG + Intronic
1192485137 X:71518456-71518478 GATTTCTTGGCCTGGCATGGTGG - Intronic
1193199012 X:78666021-78666043 GCTTTCATGGCTTGGTGTTGAGG - Intergenic
1194779878 X:98011170-98011192 GCTTTCCTGGGCCAGCATTCAGG - Intergenic
1195129628 X:101839998-101840020 CCTGTCCTGGGCTGGCATGGGGG - Intronic
1195176610 X:102319831-102319853 CCTGTCCTGGGCTGGCATGGGGG + Intronic
1195182254 X:102367262-102367284 CCTGTCCTGGGCTGGCATGGGGG - Intronic
1195202474 X:102564522-102564544 CCTGTCCTGGGCTGGCATAGGGG + Intergenic
1195341891 X:103914615-103914637 TTTTCCATGGACTGGCATTGAGG + Intergenic
1195554813 X:106210173-106210195 GTTTTTATGGGCTGGCATTGAGG + Intergenic
1196366714 X:114932254-114932276 GCTCTCAAGGGCTAGCATTGAGG + Intergenic
1196518266 X:116640147-116640169 GCTTTCATGAGCTGGCATTGAGG + Intergenic
1197180241 X:123527565-123527587 GTTGTCAGGGGCTGGCATAGAGG - Intergenic
1197223189 X:123932699-123932721 GCTTTCATAGGCTGGCATTGAGG - Intergenic
1202034982 Y:20623476-20623498 TCTTTCTTTGGCTGTCATTGGGG + Intergenic
1202596657 Y:26547845-26547867 GCTTCCCTTGGCTGGCAGTGGGG - Intergenic