ID: 1179764853

View in Genome Browser
Species Human (GRCh38)
Location 21:43564468-43564490
Sequence CTTTCATGGGCTGGCATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 15, 1: 11, 2: 25, 3: 30, 4: 154}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179764840_1179764853 19 Left 1179764840 21:43564426-43564448 CCACCCCTGTGGCTTTGCAAGGT 0: 32
1: 563
2: 853
3: 879
4: 758
Right 1179764853 21:43564468-43564490 CTTTCATGGGCTGGCATTGAGGG 0: 15
1: 11
2: 25
3: 30
4: 154
1179764845_1179764853 -8 Left 1179764845 21:43564453-43564475 CCCCTCTCCTGGCTGCTTTCATG 0: 38
1: 290
2: 583
3: 892
4: 1287
Right 1179764853 21:43564468-43564490 CTTTCATGGGCTGGCATTGAGGG 0: 15
1: 11
2: 25
3: 30
4: 154
1179764846_1179764853 -9 Left 1179764846 21:43564454-43564476 CCCTCTCCTGGCTGCTTTCATGG 0: 32
1: 168
2: 288
3: 474
4: 796
Right 1179764853 21:43564468-43564490 CTTTCATGGGCTGGCATTGAGGG 0: 15
1: 11
2: 25
3: 30
4: 154
1179764848_1179764853 -10 Left 1179764848 21:43564455-43564477 CCTCTCCTGGCTGCTTTCATGGG 0: 130
1: 293
2: 393
3: 471
4: 678
Right 1179764853 21:43564468-43564490 CTTTCATGGGCTGGCATTGAGGG 0: 15
1: 11
2: 25
3: 30
4: 154
1179764841_1179764853 16 Left 1179764841 21:43564429-43564451 CCCCTGTGGCTTTGCAAGGTATA 0: 11
1: 275
2: 1339
3: 1508
4: 1309
Right 1179764853 21:43564468-43564490 CTTTCATGGGCTGGCATTGAGGG 0: 15
1: 11
2: 25
3: 30
4: 154
1179764843_1179764853 14 Left 1179764843 21:43564431-43564453 CCTGTGGCTTTGCAAGGTATAGC 0: 12
1: 255
2: 1290
3: 1715
4: 1489
Right 1179764853 21:43564468-43564490 CTTTCATGGGCTGGCATTGAGGG 0: 15
1: 11
2: 25
3: 30
4: 154
1179764842_1179764853 15 Left 1179764842 21:43564430-43564452 CCCTGTGGCTTTGCAAGGTATAG 0: 11
1: 269
2: 1293
3: 1607
4: 1336
Right 1179764853 21:43564468-43564490 CTTTCATGGGCTGGCATTGAGGG 0: 15
1: 11
2: 25
3: 30
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179764853 Original CRISPR CTTTCATGGGCTGGCATTGA GGG Intronic
902397389 1:16139796-16139818 GCTTCTTGGCCTGGCATTGAAGG - Intronic
902976498 1:20092485-20092507 CTTTTGTGGGCTGGGGTTGAAGG - Intergenic
906350981 1:45059128-45059150 CTTTCTTGGAGTGGAATTGATGG - Intronic
912070262 1:105800749-105800771 TTTTCATGGGCAGGCATTGAGGG + Intergenic
913336981 1:117717519-117717541 CTTTCATGGCCTGGTGTTGAGGG - Intergenic
915171869 1:153983597-153983619 TTTTCATGGGATGGAATAGAGGG + Intronic
916556122 1:165895804-165895826 CTCTCATGGCCTGGCATTTATGG - Intronic
916855351 1:168743541-168743563 TTTTCACGGGCTGGAATGGAAGG + Intergenic
919498295 1:198305199-198305221 CTTTCCTGTCCTGGAATTGAGGG - Intronic
922477475 1:225916589-225916611 CCTGCAAGAGCTGGCATTGAGGG - Intronic
1063323136 10:5070996-5071018 CTTCTATGGGGTGGTATTGATGG + Intronic
1063845608 10:10124058-10124080 CATCCAGGGGCTGGAATTGAAGG - Intergenic
1065231617 10:23604531-23604553 CTTTCATTTGCAGTCATTGAAGG + Intergenic
1068433585 10:56963180-56963202 TCTTCATGGGCTGAGATTGAAGG + Intergenic
1070537704 10:77392081-77392103 CTTTCATGGGTTGGGAAGGAGGG + Intronic
1071353540 10:84770019-84770041 CTTTCGTGGGCTGTGAATGAAGG + Intergenic
1072217585 10:93300672-93300694 CTGTCATGTCATGGCATTGATGG + Intergenic
1072769335 10:98124615-98124637 CTTTCATGGGCTGGCATTGAGGG + Intergenic
1074954744 10:118377569-118377591 CTCTCAGGGGTTGGCATTGCAGG + Intergenic
1079713772 11:23718739-23718761 CTTTCACAAGCTGGCATTGAGGG - Intergenic
1080882760 11:36338176-36338198 CTACCATAGCCTGGCATTGAAGG + Intronic
1081008103 11:37773758-37773780 CTTTCACAGGCTGGCATTGAGGG + Intergenic
1081316501 11:41637301-41637323 CTTTCACGAGCTGGCATTGAGGG + Intergenic
1082126130 11:48432988-48433010 CAGTGATGGGCTGGCAGTGATGG + Intergenic
1082129030 11:48464821-48464843 CAATGATGGGCTGGCAGTGACGG + Intergenic
1082248378 11:49952559-49952581 CAGTGATGGGCTGGCAGTGATGG - Exonic
1082559719 11:54603840-54603862 CAGTGATGGGCTGGCAGTGATGG + Exonic
1082562567 11:54635797-54635819 CAATGATGGGCTGGCAGTGATGG + Intergenic
1085280240 11:75325286-75325308 CTTTTTTGGGCTGGCATTCTGGG - Intronic
1085905721 11:80759938-80759960 CTTGGATTGGATGGCATTGAAGG - Intergenic
1089533725 11:119148706-119148728 CATTCATGGGCTGGAACTGAGGG + Intergenic
1090477407 11:127036107-127036129 CTGTAATGGGCTGTCATTGATGG + Intergenic
1090616197 11:128517575-128517597 ATTCCATGAGCTTGCATTGAAGG - Intronic
1096280997 12:50253711-50253733 CTTTCATTGGCCTGCATTAAAGG + Intronic
1096570924 12:52522728-52522750 CTGTCCAGGTCTGGCATTGAGGG - Intergenic
1096584686 12:52612183-52612205 CTTTCCAGGGCTGGGATGGAGGG + Intronic
1096904969 12:54926922-54926944 CTTTCATGGGCTGGCATTGAGGG - Intergenic
1097481074 12:60126540-60126562 CTTTCATGGGCTGGCATTGAGGG - Intergenic
1097685748 12:62689371-62689393 CATGCCTGGGCTGCCATTGAAGG + Intronic
1099536861 12:83855986-83856008 CTTTCATGGGATGGCATTAAGGG - Intergenic
1100213183 12:92419399-92419421 CTTACACGGGCTGGCACTGCTGG + Intergenic
1101187081 12:102291150-102291172 CGTTCACGGGCTGGCATTGAGGG - Intergenic
1102698179 12:114816196-114816218 TTTTCATGGGCTGGGAGTGGTGG - Intergenic
1103902396 12:124310258-124310280 CTTTGCTGGGCTGGCCCTGAAGG + Intronic
1104081317 12:125432762-125432784 CTTTGATGGGCCGGCCTTGGTGG + Intronic
1106602871 13:31201940-31201962 CTTTCATGGGTTGGCACAGACGG + Intronic
1106693412 13:32144927-32144949 TTTTAACGGGCTGGAATTGAAGG + Intronic
1107350058 13:39504544-39504566 CTCTCCTTGGCTGGCATTGCAGG + Intronic
1109810768 13:67509684-67509706 CTTTCATGGGCTGGCATTGAAGG - Intergenic
1111239708 13:85457985-85458007 CTTTCATGGGCTGGCATTGAGGG - Intergenic
1113284976 13:108836568-108836590 CTTTCATGGGCTGGCATTGAGGG - Intronic
1114217098 14:20665182-20665204 CTTTCCTGGGCTGGCCTTGAGGG + Intergenic
1114794262 14:25694834-25694856 CTGTCTTGGGCTGCCAATGAGGG + Intergenic
1115708980 14:36029164-36029186 CTTTCCTGGGTTGTCATTTAAGG + Intergenic
1117015387 14:51512549-51512571 CTTGCATGGGCTAGCTTTAAGGG - Intronic
1117427868 14:55620259-55620281 CTTTCATGGGCTGGCGTTGAGGG + Intronic
1117886777 14:60372199-60372221 CTCTCATGGGCTGGGATTGTGGG - Intergenic
1118811391 14:69277010-69277032 CCCTGATGGACTGGCATTGAAGG + Intronic
1120045563 14:79801882-79801904 CATTCATGGGATGGAATTGGAGG + Intronic
1120257846 14:82142141-82142163 CTTTCACAGGCTGGCATTGAGGG + Intergenic
1122647308 14:103203703-103203725 CTGTCATGGCCTGGCACTCAAGG - Intergenic
1123119897 14:105911660-105911682 ATGTCATGGGCTGGCCTTGGGGG + Intergenic
1123149599 14:106168125-106168147 CTTTCACGAGCTGGCATTGAGGG + Intergenic
1123694388 15:22867203-22867225 CTTACATGGTCAGGGATTGATGG - Exonic
1124413418 15:29455276-29455298 CATTCATGGTCGTGCATTGATGG - Intronic
1124509028 15:30306581-30306603 CTTTCATGGGCTGGTGTTGAGGG + Intergenic
1124734529 15:32232081-32232103 CTTTCATGGGCTGGTGTTGAGGG - Intergenic
1125210423 15:37208499-37208521 CTTTCATAGGCTAGCATCGTAGG - Intergenic
1126097562 15:45100279-45100301 CTTTCATGGAGTGGCATTAAGGG - Intronic
1132221118 15:100106237-100106259 CATCCAGGGGCTGGCATAGATGG - Intronic
1132995652 16:2821123-2821145 CTTTCCTGGGCTGGGAGTGGTGG - Intronic
1136265950 16:29118515-29118537 CTGTCGTGGGTTGGCCTTGAGGG + Intergenic
1137747711 16:50835262-50835284 ATTGGATGTGCTGGCATTGAGGG - Intergenic
1138170100 16:54840834-54840856 CTATCATGGGCTGGCAATGGGGG + Intergenic
1141244291 16:82291817-82291839 ATTTCATGTTCTGGCAGTGAAGG - Intergenic
1146749173 17:35362019-35362041 CTTTCTTGGGCTGGGCTTGGTGG - Intronic
1149068307 17:52506911-52506933 ATTAAATGGGCTGTCATTGAAGG - Intergenic
1151407144 17:73895804-73895826 CTTTCAGGGGCCGGCACTGTGGG - Intergenic
1153771197 18:8417744-8417766 CTCTCATGGGCTTGCAGTCAAGG - Intergenic
1154048809 18:10933673-10933695 CTTTCATGGGTTGGAATGAAGGG + Intronic
1156492845 18:37506521-37506543 CCTTCCTGGGATGGCATAGATGG - Intronic
1164502311 19:28830268-28830290 CTTTCATGGGGTGGGAAAGAAGG + Intergenic
1164736778 19:30546909-30546931 CTTACATTTGCTGGCATTGTGGG - Intronic
1165756565 19:38296688-38296710 CATTCAGGAGCTGCCATTGATGG - Intronic
1168349794 19:55669268-55669290 CTTTCATGGGAAGGCATTTGGGG + Intronic
925546017 2:5017575-5017597 CTATCATGGGCTAGCATAAAGGG + Intergenic
925576801 2:5368715-5368737 CTTTGCTGGGCTGGTATGGAGGG - Intergenic
925988634 2:9235834-9235856 CATTCATGGGAAGGCATTGCCGG - Intronic
926467944 2:13214832-13214854 CTTTCACAGGCTGTCATTGTTGG + Intergenic
927641140 2:24846275-24846297 CTTTCATAGGCTGGCTTTGAGGG - Intronic
927844110 2:26462467-26462489 CTTCCATGGGCTTCCATTGCTGG - Intronic
928808952 2:35198570-35198592 CTTTTATGGGCTGGCATTGAGGG - Intergenic
931079490 2:58753150-58753172 CTCTCACAGGCTGGCATTGAGGG - Intergenic
933064134 2:77772806-77772828 CTTTCATGGGCTGGCATTGAGGG + Intergenic
933495455 2:83045034-83045056 TTTTCATGGAATGGAATTGAAGG - Intergenic
935340211 2:102053089-102053111 CTTAGATGGGATGCCATTGAGGG - Intergenic
935385179 2:102492148-102492170 CTTTCATGGGCTGGTGTTGAGGG + Intronic
935600027 2:104913245-104913267 CATTCCTTGGCTGGCATTAAAGG + Intergenic
937527554 2:122789159-122789181 CTTTCACAGGCTGGCATTGAGGG - Intergenic
939707842 2:145477709-145477731 AATTCATGGGCTGGCAGTGGTGG - Intergenic
942224310 2:173801893-173801915 CATTCATGGGCTGGAATATAAGG + Intergenic
943565389 2:189510169-189510191 CTTTCACTGGCTGGCTTTGAGGG - Intergenic
944936180 2:204571144-204571166 CTTGCATTGGCTGGCAAAGAAGG + Intronic
945931040 2:215854970-215854992 CTTTCATGGGTTAGAATTGAGGG - Intergenic
946534086 2:220607679-220607701 CCTTTATGGGCTGGCATTGAGGG + Intergenic
946883106 2:224195787-224195809 TTTTCACTGGCTGGCATTGGGGG + Intergenic
1171166700 20:22978233-22978255 CTTTCACAGGCTGGCAGGGATGG + Intergenic
1171300507 20:24055664-24055686 CTTTCATTGGCCTGCATTCATGG + Intergenic
1172519702 20:35558806-35558828 CTTCCAGGAGCAGGCATTGAAGG + Intergenic
1172539635 20:35700936-35700958 AGTACATGGGCTGGGATTGATGG - Exonic
1172602505 20:36193784-36193806 CATTTATGGGCTGCCATTGATGG + Intronic
1173361893 20:42352130-42352152 CTTTGCTGTGCTGGCCTTGATGG + Exonic
1173469727 20:43313710-43313732 ACTTCATGGTCCGGCATTGAGGG - Intergenic
1175407341 20:58743811-58743833 ATGTCATGGGGGGGCATTGAGGG + Intergenic
1176358665 21:5974082-5974104 CTTTCATGGGCTGGCATTGAGGG - Intergenic
1177238774 21:18428947-18428969 CTTTCATGAGTTGGCATTCAGGG - Intronic
1178145471 21:29734905-29734927 CTTTCTTGGCCTGGCATGCAGGG + Intronic
1178533225 21:33392459-33392481 CTTTCCGGGGCTGGGATTCAGGG - Intergenic
1179435751 21:41361078-41361100 CTCTCAAGGACTGGCAGTGATGG - Intergenic
1179764853 21:43564468-43564490 CTTTCATGGGCTGGCATTGAGGG + Intronic
1184077002 22:42187254-42187276 TTTTCATGGGCTTGTATTGGAGG - Intronic
949770313 3:7570622-7570644 CTTTCATGGGCTGGCATTGAGGG + Intronic
952158602 3:30670642-30670664 GTTTCATGTGCTGGCCTTGTTGG - Intronic
953050257 3:39335188-39335210 CTTGCATGGCCTTGCATTCATGG - Intergenic
953437426 3:42889572-42889594 CTTGCATGGCCTTGCATTCATGG - Intronic
955182065 3:56682366-56682388 CTTTCAGGGGCTGGGAGGGAGGG + Intronic
957762127 3:84572424-84572446 CTTTCACGGGCTGTCATTGAGGG + Intergenic
959004816 3:101008349-101008371 CTTTTATGGGCTGGTGTTGAGGG + Intergenic
959202893 3:103271303-103271325 TTTTCGTGGGCTGGCTTTGAGGG + Intergenic
960260517 3:115562962-115562984 CTTTCCAGGGGTGGCAATGAGGG + Intergenic
961403663 3:126664317-126664339 CTTTTCTGGGCTGGCAGTGAAGG + Intergenic
961791885 3:129382189-129382211 TATTCCTGGGCTGACATTGAAGG + Intergenic
961925330 3:130473451-130473473 CTGTCATGGGTTTGCTTTGAAGG + Intronic
962715186 3:138119550-138119572 CCCTCATTGGCTGGCAGTGATGG + Intergenic
964298005 3:155254934-155254956 CTTGCCTAGGCTGGCATTTAAGG - Intergenic
964897246 3:161613111-161613133 CTTTCATGGGCTGGCATTGAGGG - Intergenic
964974908 3:162606505-162606527 CTTTCACGGGTTGGCATTGACGG - Intergenic
965275437 3:166676820-166676842 CTTTCACAGGCTGACATTGAGGG + Intergenic
967792674 3:193565987-193566009 GTCTCATGGCCTGGCATTAATGG - Intronic
970334466 4:15020601-15020623 TTTTCATGGTCTGGCATAGCAGG + Intronic
972014541 4:34226747-34226769 CTTTCATGGGCTGCCATTGAGGG - Intergenic
973078561 4:45961792-45961814 CTTTCATGGGCTGGCACTGAGGG + Intergenic
975400975 4:73939331-73939353 CTTGCATGGCCTTGCATTCATGG + Intergenic
976824694 4:89248209-89248231 CCTGCGTGGGCTGGCTTTGACGG + Exonic
976853463 4:89576103-89576125 CTTTCATGGGCTGGCACTGAGGG - Intergenic
976881593 4:89932327-89932349 CTTCCATGGGCTGATTTTGAAGG + Intronic
977952791 4:102993498-102993520 CTTTCACAGGCTGGCATTGAGGG + Intronic
980646154 4:135644494-135644516 CTTTTATGGGCTGGCCTTGAGGG - Intergenic
981862949 4:149379357-149379379 CTTTCATGGGCTGGCATGGAGGG - Intergenic
983345169 4:166520238-166520260 CTTCCATGAGCAGGCATTGAAGG - Intergenic
983657451 4:170097936-170097958 CTTTCACAGGCTGGTGTTGAGGG + Intergenic
983785956 4:171729546-171729568 CTTTCATGGACTAGCATTGAGGG - Intergenic
985105739 4:186498306-186498328 CTTGCATGGAAGGGCATTGAAGG + Intronic
985169735 4:187136253-187136275 CTTTTATGACCTGGCATTGGAGG - Intergenic
987658457 5:20839686-20839708 CTCTCAAGGGCTGGTGTTGATGG - Intergenic
988805917 5:34740599-34740621 CCTTCATGGGCTTGCCTTGGAGG + Intronic
989423158 5:41264310-41264332 CTTCCCTGGGCAGGCATTGAGGG + Intergenic
990725472 5:58748861-58748883 CTTACTTTGGCTGGCATTGTTGG - Intronic
990766433 5:59188980-59189002 CTTTCATAGCCTGGCAGGGAGGG + Intronic
992633056 5:78700401-78700423 ATTTCATGGGCTGACTATGATGG - Intronic
993207010 5:84894994-84895016 CTCTCATGGGCTGGTAGTGGTGG - Intergenic
993689052 5:90976089-90976111 CTTTCAGGAATTGGCATTGAGGG - Intronic
994580241 5:101632463-101632485 CTTTCACAGGATGGCATTTAGGG + Intergenic
995477634 5:112563827-112563849 CTTTCACAGGCTGCCATTGAGGG - Intergenic
995703546 5:114961755-114961777 CTTTCACTGGCTGGCATTGAGGG + Intergenic
996771926 5:127095346-127095368 CTCTCATGGGATGGCTTTCAAGG + Intergenic
997623779 5:135318189-135318211 CTTTCCTGGGCTGGCAGGGCCGG + Intronic
999061515 5:148640489-148640511 CTCCCATGGGGTGGCAATGATGG - Intronic
999571668 5:152926019-152926041 CTTTCTCAGGCTGTCATTGAGGG - Intergenic
1000884231 5:166733040-166733062 CTTTCTTGGAATGGGATTGAAGG - Intergenic
1007662172 6:43493542-43493564 CTCTCCTGGGCTGGTGTTGAAGG + Intronic
1008188695 6:48427091-48427113 CTTTTATGGTCTGTCAGTGAGGG - Intergenic
1008432120 6:51431007-51431029 CTTTCTTAGTCTGGCATTCAAGG + Intergenic
1008629716 6:53351610-53351632 CTTACATGGGCTCACATTGTTGG - Intergenic
1009527342 6:64764020-64764042 CTTTCATGGTCTGGCATTGAGGG + Intronic
1011835118 6:91421752-91421774 CTTTCATGGGCTGGGATTGAGGG - Intergenic
1012029254 6:94037323-94037345 CTTTCACAGGCTGGTGTTGAGGG - Intergenic
1012281098 6:97328919-97328941 CTTTCACAGGCTGGTATTGAGGG - Intergenic
1012429978 6:99153956-99153978 CTCTCATGTGATGGCATTCAAGG - Intergenic
1012823918 6:104123984-104124006 CCTTCAAGGGCTGACATTGAAGG - Intergenic
1013648966 6:112174423-112174445 CTTTCATGGGTTGGCAATTCAGG - Intronic
1015788154 6:136939238-136939260 TTTTCAAGGTCTGCCATTGAAGG - Intergenic
1016980022 6:149845442-149845464 CTTTGGAGGGCTGGCAATGACGG + Intronic
1020765660 7:12317081-12317103 CTCTCATGAGCTTGCAGTGAGGG + Intergenic
1022025443 7:26443986-26444008 CTTCCTGGGGCTGGCAGTGAAGG + Intergenic
1022862563 7:34383167-34383189 CTTTCATGGGCTGGCATTGAGGG - Intergenic
1027395235 7:77746984-77747006 CTCTCAAGGGCTGGTATTGAGGG + Intronic
1027475967 7:78631642-78631664 TTTACATGGGCTTGCCTTGATGG + Intronic
1028359968 7:89955770-89955792 CTTTCATGGACTGGCATGGAGGG + Intergenic
1029400820 7:100344741-100344763 TTTTCAGGGGCTGGCACTGTAGG + Intronic
1031111559 7:117616688-117616710 CTTTCATCTTGTGGCATTGAAGG + Intronic
1031937363 7:127749407-127749429 CTTCTGTGGGCTGTCATTGAAGG + Intronic
1033735209 7:144215169-144215191 CTTTCACGGGCTGGCGTTTAGGG - Intergenic
1033747847 7:144335800-144335822 CTTTCACGGGCTGGCGTTTAGGG + Intergenic
1038584130 8:28774478-28774500 TTTACAGGGGCTGGGATTGACGG - Intronic
1040583327 8:48715762-48715784 CTTTTATGGGCTGCCTTTGGTGG - Intronic
1042726733 8:71887491-71887513 TTTTCAGTGTCTGGCATTGAAGG + Intronic
1044205082 8:89484492-89484514 CTTTATTGTGCTGGCATTCAAGG + Intergenic
1045816491 8:106282755-106282777 CTTTCTTGGGGTGGCAGAGATGG + Intronic
1046034283 8:108822026-108822048 CTCTCATGGGCTGATGTTGAGGG - Intergenic
1046368703 8:113271823-113271845 CTTTCACTGGCTGGCATTGAGGG - Intronic
1046917447 8:119692379-119692401 CTTTCATGGGCTGGCATTGAGGG - Intergenic
1048190751 8:132286197-132286219 CTTTCTTAGGCAGGCATTGCAGG - Intronic
1048395359 8:134009430-134009452 CTTTCCTGGGCTGGGAGAGATGG + Intergenic
1051089112 9:13385476-13385498 CTTTCATGGGCTGGCATCAAGGG - Intergenic
1052518141 9:29510017-29510039 CTTTCACAGGGTGCCATTGAGGG + Intergenic
1053536246 9:38929181-38929203 TTTTCATGGCCTGTCATTGTGGG - Intergenic
1054629889 9:67434767-67434789 TTTTCATGGCCTGTCATTGTGGG + Intergenic
1055058860 9:72048336-72048358 CTTTCAAAGGCTGGCATTTGAGG + Intergenic
1056294250 9:85175727-85175749 CATTCATGCGCTGCCATGGATGG + Intergenic
1058032406 9:100214656-100214678 CATTCAGGAGCTGTCATTGATGG + Intronic
1058738247 9:107916829-107916851 GTTTCATGGGCTGGGACTGAAGG + Intergenic
1059255914 9:112930521-112930543 CTTTCATGAGCTGGCATTCAAGG + Intergenic
1059433734 9:114264575-114264597 CTTTATTGGGCTTGCAGTGAGGG - Intronic
1059507261 9:114810935-114810957 CTTTCCTGGACTGGCATCGATGG + Intergenic
1060027229 9:120183481-120183503 GTGTCATGGGCTGGCAATGCTGG - Intergenic
1062737420 9:138144938-138144960 CTCTCATGGGGTGGGTTTGAGGG + Intergenic
1187097168 X:16161356-16161378 CTTTCACAGGCTGGTGTTGAGGG + Intergenic
1188052933 X:25509219-25509241 CTTTCATGGGCAGGCATTGAGGG + Intergenic
1188705989 X:33331203-33331225 CATTCATGGGCTGGTTTTGGTGG - Intronic
1188926581 X:36051315-36051337 CTTTCATGGGCTGGCATTGAGGG - Intronic
1191710946 X:64149535-64149557 CTTTCACTGGCCAGCATTGAGGG + Intergenic
1193199011 X:78666020-78666042 CTTTCATGGCTTGGTGTTGAGGG - Intergenic
1194779877 X:98011169-98011191 CTTTCCTGGGCCAGCATTCAGGG - Intergenic
1194798600 X:98242528-98242550 TTTTCATGGGCTGGATTTGGAGG + Intergenic
1195341892 X:103914616-103914638 TTTCCATGGACTGGCATTGAGGG + Intergenic
1195554814 X:106210174-106210196 TTTTTATGGGCTGGCATTGAGGG + Intergenic
1196366715 X:114932255-114932277 CTCTCAAGGGCTAGCATTGAGGG + Intergenic
1196518267 X:116640148-116640170 CTTTCATGAGCTGGCATTGAGGG + Intergenic
1196852081 X:119947301-119947323 GTTTCATGAGTTGGCAGTGAGGG + Intergenic
1197180240 X:123527564-123527586 TTGTCAGGGGCTGGCATAGAGGG - Intergenic
1197223188 X:123932698-123932720 CTTTCATAGGCTGGCATTGAGGG - Intergenic
1199043257 X:143139392-143139414 CTTTCATGGGCTGGCATTGACGG - Intergenic
1199522159 X:148748530-148748552 CTTTTATGGGCTGACACTCATGG - Intronic
1200925394 Y:8649729-8649751 ATGTCATGGGCTGGCATTTGTGG + Intergenic