ID: 1179765658

View in Genome Browser
Species Human (GRCh38)
Location 21:43571273-43571295
Sequence CTGCGTGGACAGAGGGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 2, 1: 0, 2: 1, 3: 14, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179765658 Original CRISPR CTGCGTGGACAGAGGGCGGA GGG (reversed) Intronic
900548494 1:3241827-3241849 CAGCGTGGACAGAGGGAGGGCGG + Intronic
900930388 1:5733497-5733519 GTGCGTGGACTGATGGGGGACGG - Intergenic
900930394 1:5733525-5733547 GTGCGTGGACTGATGGGGGACGG - Intergenic
900930400 1:5733553-5733575 GTGCGTGGACTGATGGGGGACGG - Intergenic
900930406 1:5733581-5733603 GTGCGTGGACTGATGGGGGACGG - Intergenic
900930412 1:5733609-5733631 GTGCGTGGACTGATGGGGGACGG - Intergenic
900986065 1:6073334-6073356 CTGCTGGGACAGAGCGGGGAGGG - Intronic
901066344 1:6496498-6496520 CTGCATGGACAAGGGGCGGGCGG - Exonic
901315392 1:8304034-8304056 CTGAGTGGACAGAGGGAGGCAGG + Intergenic
901444105 1:9296804-9296826 TTGCTTGGACAAAGGGAGGATGG + Intronic
906165797 1:43685132-43685154 CTAGGTGGACAGAGGAGGGAGGG + Intronic
906838462 1:49109493-49109515 CTGAGTGGACACTGGGAGGAAGG - Intronic
911108748 1:94161191-94161213 CTTCTGGGACAGAGGGTGGAGGG + Intronic
913220155 1:116653632-116653654 CTGGGTGGGTAGAGGGTGGAAGG - Intronic
914751513 1:150538057-150538079 CTCAGTGGACAAAGGGTGGACGG - Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915720663 1:157983039-157983061 CAGTGTGGACAGAGGGCAGCGGG - Intergenic
916841950 1:168609862-168609884 CTGAGGAGACAGAGGGGGGAGGG + Intergenic
918218651 1:182415650-182415672 CTGCCTGGTCAGAGGGAGGAGGG + Intergenic
1065487605 10:26249877-26249899 CTGCCAGGACAGAGGCAGGAGGG + Intronic
1067766428 10:49090901-49090923 CTCCCTGGACACAGGACGGATGG - Intronic
1068561512 10:58519929-58519951 ATGTGTGGACAGTGGGAGGAGGG - Intronic
1072306568 10:94113478-94113500 CTGAGTGTTCAGAGGGTGGATGG + Intronic
1076830535 10:132992224-132992246 CCTCGAGGACAGAGGGTGGACGG + Intergenic
1077015139 11:395995-396017 GTGGGTGGGCAGAGGGTGGAGGG - Intronic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1080679562 11:34461416-34461438 CTGCGTGGGCAGAGGGCACGTGG + Intronic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083849029 11:65354808-65354830 CTGCGCGGACGGCGGGCGGGCGG - Exonic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084751318 11:71205896-71205918 CTGGGGGGACACAGGGCTGAGGG - Intronic
1084960233 11:72712635-72712657 CTGTGTGGACAGAGGGGGCGTGG - Intronic
1085527941 11:77174923-77174945 CTGAGTGCACAGAGGGCAGGAGG + Intronic
1088122439 11:106385998-106386020 AGGCATGGACAGAGGGAGGAAGG - Intergenic
1089573000 11:119422610-119422632 CTGGGTGGAAGGCGGGCGGACGG - Intronic
1092526428 12:9312716-9312738 CTGGGTGGACAGATGGGGGCTGG + Intergenic
1092560179 12:9604520-9604542 CTGCGTGGAGAGTGAGCGTATGG - Intronic
1094512199 12:31103416-31103438 CTGGGTGGACAGATGGGGGCTGG + Intronic
1096747394 12:53737881-53737903 CTGCGTGGACAGAGCTCCAAAGG + Intergenic
1102203473 12:111074552-111074574 CAGCTTGGACAGGGGGCTGAGGG + Intronic
1103081402 12:118026866-118026888 CTGTGTAGACAGAGGGGGAAAGG - Intronic
1103480465 12:121247125-121247147 CTCCGCCGAGAGAGGGCGGACGG - Intronic
1103494706 12:121352614-121352636 CTACGTGGACAGGGACCGGATGG + Intronic
1103572779 12:121856289-121856311 CTGGGTGGACTGAGAGAGGAAGG - Intronic
1104425681 12:128675716-128675738 GTGGGTGGACAGATGGAGGAAGG + Intronic
1105057122 12:133112230-133112252 CTCCATGGGCAGAGGGTGGAGGG - Exonic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106309038 13:28536861-28536883 CTGGGTTGACAGAGGTCAGAAGG + Intergenic
1109263034 13:60165494-60165516 CTCCGTGGAAAGAGGTGGGAAGG + Intergenic
1113175988 13:107564678-107564700 TTTCTTGGACAGAGGGAGGAAGG - Intronic
1113948747 13:114059587-114059609 CTGCGGGCACAGAGGGCGCTCGG + Intronic
1117645246 14:57844817-57844839 TTCTATGGACAGAGGGCGGAGGG - Intronic
1118345672 14:64939117-64939139 GTTCTTTGACAGAGGGCGGAGGG - Intronic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121782567 14:96631344-96631366 CTGAGAGGACAGAGAGCAGATGG + Intergenic
1122325483 14:100878930-100878952 CTGCGAGGACACAGAGGGGAAGG - Intergenic
1122891773 14:104735320-104735342 CTGAGAGGACACAGGGCTGATGG + Intronic
1124023706 15:25945663-25945685 CTGTGTGAGCAGTGGGCGGAGGG + Intergenic
1125885196 15:43224170-43224192 CCGCGTGGACACAGGGAAGAGGG - Intergenic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1128793679 15:70450087-70450109 ATGGGTGGACAGAGGGATGAGGG + Intergenic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1133699797 16:8298307-8298329 CTGCGTGCTCATACGGCGGAGGG - Intergenic
1134265138 16:12686042-12686064 CTGTGTGGACAGAGGGCCACGGG - Intronic
1135878519 16:26228767-26228789 CTTCGTGGACAAAGGACTGATGG - Intergenic
1139476050 16:67203096-67203118 CTGCGTGGAGAAAGGGAAGAGGG - Intronic
1140853252 16:78954301-78954323 CTGAGTGGATAGAAGGTGGATGG + Intronic
1141431128 16:83970595-83970617 AGGCGAGGACAGAGGGTGGAAGG + Intronic
1144878013 17:18412353-18412375 CTGCGGGGAGAGGGGGAGGAGGG + Intergenic
1145154217 17:20532072-20532094 CTGCGGGGAGAGGGGGAGGAGGG - Intergenic
1145312378 17:21707706-21707728 CTGGGTGGAGAGTGGGCTGAAGG - Intergenic
1145785097 17:27588452-27588474 CTGCAGGGAAAGAGGCCGGATGG - Intronic
1149442657 17:56688009-56688031 ATTAGTGGACAGAGGGTGGATGG + Intergenic
1149543998 17:57489537-57489559 CTCAGTGGACAGAGGCCGGCGGG + Intronic
1149666395 17:58367695-58367717 GTGACTGGACAGAGGGTGGAGGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151827609 17:76531847-76531869 CGGCTTGGCCAGAGGGAGGAGGG - Intronic
1152151153 17:78602214-78602236 CTGCGTGGACAAAGAGCAGACGG - Intergenic
1152337343 17:79706338-79706360 CTGCTTGGACGGAAGGTGGATGG - Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1157680726 18:49603363-49603385 GAGTGTGGCCAGAGGGCGGATGG - Intergenic
1160537850 18:79604459-79604481 CTGCGTGCCCAGGGGGCAGAGGG - Intergenic
1160548753 18:79679928-79679950 CATCGCGGACAGAGGGCGGGCGG - Exonic
1160835465 19:1122710-1122732 CGGCGTGGGCAAAGGCCGGACGG - Exonic
1161002555 19:1918104-1918126 CTGCGAAGAGAGAGGGAGGACGG - Intronic
1161053186 19:2176214-2176236 CTGTGTGGACCGAGGGCTGGGGG - Intronic
1161118540 19:2512698-2512720 CTGCCAGGGCAGAGGGAGGAGGG - Exonic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1162131769 19:8530366-8530388 CTGCGGGGACAGAGGGTGGAGGG + Intronic
1162743114 19:12784125-12784147 CTGGCTGGACAGACGGAGGAGGG + Intronic
1164500917 19:28819573-28819595 CTGCCAGCACAGAGGGCAGAGGG - Intergenic
1164617713 19:29676770-29676792 CTGCCTGGGCAGAGGGCACAGGG + Intergenic
1164676457 19:30104774-30104796 CTGCATGGACACAGAGGGGATGG - Intergenic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1166347775 19:42177037-42177059 CTGCGAGGGGAGAGGGAGGAAGG + Intronic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1166938588 19:46349820-46349842 CTGCCTGGAGAGAGGGTGGACGG + Intronic
1166985718 19:46659276-46659298 CCGGGAGGACAGAGGGCTGAGGG + Intronic
1167104490 19:47422069-47422091 TGGCGTGGCCAGCGGGCGGAGGG - Intergenic
1167792985 19:51692297-51692319 CTGCCTGGCCGGAGGGAGGAGGG + Intergenic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG + Intronic
928331313 2:30360025-30360047 GAGTGTGGACAGAGGGCAGAGGG + Intergenic
929471306 2:42196760-42196782 CTGCATGGGCAGAGGGGGAAGGG - Intronic
930707476 2:54519164-54519186 CTGCCTGGACAGGTGGCAGAGGG - Intronic
933943704 2:87266461-87266483 CTGTGTGGACAGTGGGCTGGAGG + Intergenic
934851972 2:97707318-97707340 CTGCGTGGAGAGCTGGGGGAGGG + Intergenic
934965369 2:98716987-98717009 CTGTGTATACAGAGGGCCGACGG + Intronic
936336516 2:111595118-111595140 CTGTGTGGACAGTGGGCTGGAGG - Intergenic
936954869 2:118013757-118013779 CTGCATGGGCAGGGGGCGGCGGG - Intronic
937098005 2:119248222-119248244 CTGAGTTGCCAGAGGGAGGAAGG - Intronic
937903578 2:127040666-127040688 CTGCCTGGAATGAGGGCGGGAGG - Intergenic
940495408 2:154422005-154422027 CAGCGTGCACAGAGAGCAGAGGG + Intronic
945332436 2:208555562-208555584 TTTCGTGGACAGAGAGAGGATGG - Intronic
946486474 2:220105323-220105345 CTGGGTGGAGAGAGGAAGGAGGG + Intergenic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948858924 2:240743545-240743567 CTGCGTGGACTGAGGGAGCTAGG + Intronic
948867257 2:240782387-240782409 CTGCGGGGACGGAGGGCGTCCGG - Intronic
1169914739 20:10673875-10673897 CTGCATGGAAAAAGGGGGGAGGG + Exonic
1169922899 20:10754444-10754466 TTGCGTAGAGAGAGGGAGGAGGG + Intergenic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1174905222 20:54543313-54543335 CTTCGTGGACAGTGGGGGGTGGG + Intronic
1175798956 20:61790121-61790143 ATGGGTGGACAGAGGATGGATGG - Intronic
1176305307 21:5120127-5120149 CTGCCTGCGCAGAGGGCGGCAGG - Intronic
1176357860 21:5967278-5967300 CTGCGTGGACAGAGGGCGGAGGG + Intergenic
1177761971 21:25412281-25412303 CTGTGTGGACAGATGGCTCAAGG + Intergenic
1179435682 21:41360602-41360624 CTGCCTTGACAGAGGGTGGAGGG + Intergenic
1179603528 21:42496759-42496781 CTGCGAGGCCTGGGGGCGGAAGG - Intronic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179765658 21:43571273-43571295 CTGCGTGGACAGAGGGCGGAGGG - Intronic
1179851748 21:44141904-44141926 CTGCCTGCGCAGAGGGCGGCAGG + Intronic
1180033515 21:45229050-45229072 CTGCTTGGCCAGAAGGCAGAAGG - Intergenic
1180217758 21:46336724-46336746 CTCCGTGGACAGAGTGAGGAAGG + Intronic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1182208892 22:28656763-28656785 TGGCGTGGAGAGAGGGGGGAAGG + Intronic
1183160622 22:36110629-36110651 CTGCCTGGGCAGAGGTGGGAGGG - Intergenic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1183675573 22:39297214-39297236 CAGCGTGGAGACAGGGCGGGAGG + Intergenic
1184996083 22:48208673-48208695 CTGCGTGGACAGTGCCCGGAAGG - Intergenic
1185224163 22:49643634-49643656 CGGCGTGGACACAGCCCGGAAGG - Intronic
949987467 3:9552466-9552488 CTGCGTGGGCAGCGGGCTGGCGG - Exonic
950003791 3:9678181-9678203 CTGAGAGGACAGAGGGCCAAAGG - Intronic
952879324 3:37973522-37973544 CAGCGAGGAAAGAGGGTGGAAGG - Intronic
957785323 3:84875039-84875061 CAGCGTGAACAGAGGGCCTATGG - Intergenic
960732699 3:120743822-120743844 CAGGGTAGACAGAGGGCAGAGGG + Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
966622465 3:181980645-181980667 CTGCATGCACAGAGGGGGGGGGG + Intergenic
968425584 4:520830-520852 CTGCATCGCCAGAGGGCAGATGG + Intronic
968584051 4:1407752-1407774 CTGCGTGGGCAGGAGGAGGAGGG - Intergenic
975385162 4:73749545-73749567 CAGAGTAGACAGAGGGTGGAGGG + Intergenic
976656825 4:87497412-87497434 CTGCTTGGGCAGTAGGCGGATGG - Intronic
978843932 4:113249486-113249508 CTGTGTGGACAGAGGGTCAATGG - Intronic
985616829 5:927553-927575 CTGCGGGGGCAAAGGCCGGAAGG - Intergenic
985787864 5:1909190-1909212 GTGCCTGGACAGGGGGAGGAAGG - Intergenic
986172805 5:5327412-5327434 TTGCATGGACAGAGGGCCGAGGG + Intergenic
996398430 5:123035825-123035847 CTGCGGGGAAAGGGGGCGGGGGG - Intronic
1003165093 6:3670592-3670614 CTGGGTGGACTCAGGGCTGAGGG + Intergenic
1006115813 6:31775704-31775726 CTGCGAGGTCAGAGAGCTGAGGG - Intronic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006654892 6:35582471-35582493 GTGAGTGGAGAGAGGGCAGAGGG - Intronic
1007656750 6:43455365-43455387 CTGCGGGGACAGGGCGCGGTGGG - Intronic
1007957882 6:45933746-45933768 CTGGGTGGACAGAGAGGGGCAGG + Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1018305677 6:162452798-162452820 CTACGTGGACAGAGGGAAGTGGG + Intronic
1019215264 6:170439040-170439062 CTGGGGGGACAGAAGGCTGAGGG + Intergenic
1020253968 7:6491395-6491417 CTGCGTGGACAGCGGTGGGAAGG + Intergenic
1025032863 7:55571947-55571969 CGGCGGGGAGAGGGGGCGGACGG + Intronic
1026902598 7:74045302-74045324 CTGTCTGGACAGAGGGCTGATGG + Intronic
1026907813 7:74072793-74072815 CTGAGTGGAGAGAAGGCCGAAGG - Intergenic
1030115267 7:106058091-106058113 CTGCGTGGGCAGCAGGTGGAGGG + Intergenic
1032200875 7:129821945-129821967 CTGCATGGCCAGAAGGCCGAGGG - Intergenic
1032306816 7:130741796-130741818 CTGCCTTTACAGAGGGAGGAAGG - Intergenic
1034413503 7:150953414-150953436 CTGTGTGGAGAGGGGGCTGAGGG - Intronic
1035203653 7:157281361-157281383 CTGCAGAGACAGAGGGCAGATGG + Intergenic
1039265836 8:35823011-35823033 CTGAGTGGACAGACTGAGGAGGG - Intergenic
1039419049 8:37420368-37420390 CTGCGGGGACAGGAGGCGGGGGG - Intergenic
1040537582 8:48323329-48323351 CTGAGTGGAGACAGGGCAGAGGG + Intergenic
1040969248 8:53115600-53115622 CTGGGTGGACAGTGGGCTGGGGG - Intergenic
1042785085 8:72537364-72537386 CCGCGGGGGCGGAGGGCGGAGGG - Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1049592184 8:143467771-143467793 CTGCCTGGGCAGAGGGCGGGAGG - Intronic
1049905439 9:212454-212476 CTCTCTGGACAGAGGGCTGATGG + Intergenic
1050589210 9:7145178-7145200 GTGCGTGGCCAGAGGGTGGCGGG + Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1060217489 9:121747010-121747032 CTGAGTGGAGAGATGGGGGAGGG + Intronic
1060954565 9:127629375-127629397 CTGTGTGGAGAGTGGGCGGGAGG + Intronic
1061196447 9:129109721-129109743 CTACGGGGCCAGAGGGCGGAGGG - Intronic
1061626656 9:131844382-131844404 CTCGGTGGCCAGAGGGCGGAGGG + Intergenic
1061680771 9:132241509-132241531 TTGCGGGGACAGAGGGAGGGAGG + Intronic
1062049123 9:134438129-134438151 GTGCCTGAACAGAGGGTGGATGG + Intronic
1062606046 9:137349306-137349328 CTCCCGGGACAGAGGGCGGGAGG + Intronic
1200098125 X:153673639-153673661 CTGCGTGGACCGAGCGCGTGCGG + Intronic