ID: 1179769524

View in Genome Browser
Species Human (GRCh38)
Location 21:43603994-43604016
Sequence ATGAGCCAGCTCTGCATTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179769514_1179769524 24 Left 1179769514 21:43603947-43603969 CCTGCAGGGCCCACAGGGATTTC No data
Right 1179769524 21:43603994-43604016 ATGAGCCAGCTCTGCATTCTGGG No data
1179769519_1179769524 15 Left 1179769519 21:43603956-43603978 CCCACAGGGATTTCTGGGGGAGG No data
Right 1179769524 21:43603994-43604016 ATGAGCCAGCTCTGCATTCTGGG No data
1179769521_1179769524 14 Left 1179769521 21:43603957-43603979 CCACAGGGATTTCTGGGGGAGGC No data
Right 1179769524 21:43603994-43604016 ATGAGCCAGCTCTGCATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179769524 Original CRISPR ATGAGCCAGCTCTGCATTCT GGG Intronic