ID: 1179769840

View in Genome Browser
Species Human (GRCh38)
Location 21:43606339-43606361
Sequence GATCCAAGGTTGAAAGCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179769834_1179769840 13 Left 1179769834 21:43606303-43606325 CCAGCTGTAGGAACAGAGAAGAA 0: 1
1: 0
2: 2
3: 27
4: 284
Right 1179769840 21:43606339-43606361 GATCCAAGGTTGAAAGCATCAGG 0: 1
1: 0
2: 1
3: 5
4: 91
1179769833_1179769840 14 Left 1179769833 21:43606302-43606324 CCCAGCTGTAGGAACAGAGAAGA 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1179769840 21:43606339-43606361 GATCCAAGGTTGAAAGCATCAGG 0: 1
1: 0
2: 1
3: 5
4: 91
1179769830_1179769840 28 Left 1179769830 21:43606288-43606310 CCTCACTCAACAGCCCCAGCTGT 0: 1
1: 0
2: 2
3: 22
4: 303
Right 1179769840 21:43606339-43606361 GATCCAAGGTTGAAAGCATCAGG 0: 1
1: 0
2: 1
3: 5
4: 91
1179769832_1179769840 15 Left 1179769832 21:43606301-43606323 CCCCAGCTGTAGGAACAGAGAAG 0: 1
1: 0
2: 4
3: 31
4: 286
Right 1179769840 21:43606339-43606361 GATCCAAGGTTGAAAGCATCAGG 0: 1
1: 0
2: 1
3: 5
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179769840 Original CRISPR GATCCAAGGTTGAAAGCATC AGG Intronic
904839800 1:33364966-33364988 GACCCAAAGCTGAAAGTATCTGG - Intronic
908850015 1:68366396-68366418 GGTCCAAGGATGAAAGCTTGAGG - Intergenic
924083662 1:240425707-240425729 GATCCAAGATTGAGAGCATATGG + Intronic
1063277191 10:4582586-4582608 GATCATAGGTAGAAAGCATTAGG + Intergenic
1070325524 10:75386299-75386321 GCTCCAAGATGGAAAGAATCTGG + Intergenic
1073034248 10:100552234-100552256 GATCCAAGGATGAAGGAATGCGG + Exonic
1075282698 10:121154113-121154135 AATCCAAAGTTGTTAGCATCAGG + Intergenic
1076980278 11:200455-200477 GGTTCAAGGCAGAAAGCATCAGG - Intronic
1086594823 11:88558169-88558191 GAACCAAGGTGGGAAGCATAAGG + Intronic
1091089350 11:132755440-132755462 GATCCAAGTTTGAATAAATCAGG - Intronic
1094553911 12:31479113-31479135 GATCCAAAGTTGATTGCCTCAGG + Intronic
1097957505 12:65501227-65501249 GAGCCAAGGTGGAAAGCTCCAGG - Intergenic
1099946048 12:89245507-89245529 GATCCCTGGCTGAAAGCATTAGG + Intergenic
1100275780 12:93070560-93070582 TGACCAAGGTTTAAAGCATCTGG + Intergenic
1101558464 12:105832889-105832911 GAGCCACGGTAGAAAGCAACAGG - Intergenic
1105933813 13:25079194-25079216 GTTCTAAGGTTGAAAGCACTTGG - Intergenic
1110679866 13:78296718-78296740 GATCCAAGATGGAAAACAACAGG - Intergenic
1113363399 13:109652768-109652790 GATACAGGGTTAAAAGCCTCAGG + Intergenic
1115287078 14:31726382-31726404 GATCCAAGGGTGAAAACTACTGG + Intronic
1117845134 14:59903756-59903778 CCTCCAAGCTTGAAAGCAACTGG + Intergenic
1118204933 14:63714110-63714132 AGTCCAAGGCTGAAAGCCTCAGG - Intronic
1118752164 14:68815419-68815441 TACCCAAGGTTGAAAACATTTGG + Intergenic
1118916589 14:70112555-70112577 GAGCCAAGGTTGAGGGCTTCTGG + Intronic
1125285072 15:38083693-38083715 AAACCAAGGTTGAAGGCATATGG - Intergenic
1126751630 15:51883629-51883651 CAGCCAAGGTTGACAGCAACTGG - Intronic
1131731240 15:95283611-95283633 GATCCAAGATGGAGGGCATCTGG + Intergenic
1137840851 16:51639674-51639696 ATTCCAAGGATGAAAGCTTCAGG + Intergenic
1138648599 16:58443689-58443711 AATCCAAGGTTGAGAACATTAGG - Intergenic
1142280744 16:89146395-89146417 GATCCAGGGTTGACACCAGCTGG + Intronic
1143946655 17:10598589-10598611 GACCCCAGGTTGAGAGCTTCTGG + Intergenic
1154225850 18:12503153-12503175 GATGAAAGATTGATAGCATCTGG - Intronic
1156112510 18:33745157-33745179 GAGCCAAGCTTGAAATCAACAGG + Exonic
1156701875 18:39835582-39835604 GATCATAGGTTGAAATCATAGGG - Intergenic
1158323152 18:56285337-56285359 AGTCCAAGGATGAAAGCCTCAGG - Intergenic
1168340049 19:55617522-55617544 GAACAAAGGCTGAAAGCATCCGG - Exonic
925250579 2:2433628-2433650 GGTCCACGGTTGGAAGCATGTGG + Intergenic
935750467 2:106228624-106228646 AATCTTAGGGTGAAAGCATCTGG + Intergenic
938655157 2:133423983-133424005 CATCCAAGTTAGAAAGCAACTGG + Intronic
939000461 2:136728271-136728293 GCTCCAAGGTTCAAAGCCTGTGG + Intergenic
943237563 2:185341487-185341509 AATCCAAGGCTGAAAGCTTCAGG - Intergenic
943699144 2:190971321-190971343 CATCCTCGATTGAAAGCATCTGG - Intronic
946607125 2:221417507-221417529 GATCCTAGGTTGAAAGCACCTGG + Intergenic
1168925339 20:1574572-1574594 CAGCCAAGGTTGAAAGCCACTGG + Intronic
1168929217 20:1607600-1607622 CAGCCAAGGTTGAAAGCCACTGG + Intronic
1170718850 20:18857265-18857287 CAGCCAAGGTTGAGAGCAACTGG - Intergenic
1179367929 21:40775692-40775714 AGTCCAAGGTTGAAAACCTCAGG - Intronic
1179769840 21:43606339-43606361 GATCCAAGGTTGAAAGCATCAGG + Intronic
1180005215 21:45017640-45017662 GAGCCAAGCTGGAAAGTATCAGG + Intergenic
949686182 3:6574399-6574421 GATCAAAAGTTAAAAACATCTGG + Intergenic
951105874 3:18742008-18742030 GATACAGGGTTTACAGCATCAGG - Intergenic
951480024 3:23150691-23150713 CACCCAAGGTTGAAAGCCACCGG - Intergenic
952090770 3:29882645-29882667 AATCTAAGCTTGAAAGCAGCAGG + Intronic
953564025 3:44015735-44015757 TATCCAGGGTTGACAGCATATGG - Intergenic
954571119 3:51641749-51641771 GAGCCAAGGTGGAAAGACTCTGG - Exonic
955266906 3:57453196-57453218 GATAAAATGTTGATAGCATCTGG - Intronic
961170050 3:124790999-124791021 TAGAGAAGGTTGAAAGCATCTGG + Intronic
965462775 3:168989030-168989052 AATGCAAGGATCAAAGCATCTGG - Intergenic
965517766 3:169640319-169640341 CATCCAAGGTTGAAAGAAGTTGG + Intronic
967138871 3:186536201-186536223 GATTGCAGGTTGAAAGCTTCAGG + Intergenic
970142176 4:12994701-12994723 GAGCAGAGGTTGAAAGCATGTGG - Intergenic
972397211 4:38667685-38667707 GATCCAAAATTGACAGCTTCAGG - Intronic
973807752 4:54541740-54541762 GCTCCAATGTAGATAGCATCTGG - Intergenic
977716199 4:100186535-100186557 TATCCAAGGTGGAAAAAATCTGG + Exonic
980690022 4:136283628-136283650 TTTCCAAAGTAGAAAGCATCAGG + Intergenic
982385892 4:154801955-154801977 GATACAAGGTTGATAAAATCTGG - Intronic
982950822 4:161693426-161693448 AATCCAACAATGAAAGCATCTGG + Intronic
984384857 4:179043525-179043547 GATTCAAGGATGAACCCATCAGG - Intergenic
987097813 5:14565721-14565743 GGTCCAAGGTTGAAATGATATGG - Intergenic
987960102 5:24796027-24796049 GATCCATGGTAAAAAGCATATGG - Intergenic
988197130 5:28018360-28018382 TATCCAAGGTTGAAAACATAAGG + Intergenic
989712824 5:44421453-44421475 GAGCCAAGGTTGACAGCCACTGG + Intergenic
991643898 5:68781392-68781414 AATCCCAGGTTGAAACCATTTGG + Intergenic
995015244 5:107302356-107302378 GGTCCCAGATTGAAAACATCAGG + Intergenic
998609898 5:143676821-143676843 TACCAGAGGTTGAAAGCATCAGG + Intergenic
1002295662 5:178229767-178229789 GATCCAACAGAGAAAGCATCAGG + Intronic
1004980949 6:21023026-21023048 GATCTAAAGTTGAAGGCATGAGG + Intronic
1007114534 6:39334279-39334301 GATCTAATGTTGAAAGACTCTGG + Exonic
1007357612 6:41332771-41332793 GATGCCAGGTTCAAAGCATCTGG - Intergenic
1017984475 6:159431520-159431542 CATTGAAGGTTGAAAACATCTGG + Intergenic
1018754129 6:166834047-166834069 TATCTAAGGGTGAAAGCATTGGG + Intronic
1019105379 6:169663264-169663286 AAACCAAGGTTTAAAACATCAGG + Intronic
1022270010 7:28797697-28797719 TCTCCAAGTTTGAAAGCATTTGG + Intronic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1028512280 7:91638473-91638495 GATCCCAGGTGGCATGCATCTGG - Intergenic
1030645517 7:112056862-112056884 TATACAAGGTTGAAATAATCAGG + Intronic
1033918809 7:146362360-146362382 GGTCCAAGGTAGACAGCACCTGG + Intronic
1036434225 8:8718018-8718040 GATTCAAGGTTGAAAGCTCAGGG + Intergenic
1045818992 8:106312630-106312652 GATCCAAGCTTGAATGACTCAGG + Intronic
1048374135 8:133807502-133807524 AATCAAATTTTGAAAGCATCTGG + Intergenic
1056304386 9:85274835-85274857 GGTCAAAGGTAGAAAGCAACAGG - Intergenic
1056318131 9:85410793-85410815 TATCAAAAGTTGACAGCATCAGG + Intergenic
1061927417 9:133812687-133812709 GATCCAAGGTGCAAAGTTTCCGG + Intronic
1186545663 X:10446569-10446591 GATCCAAAGTTGAAAGTTGCTGG - Exonic
1187215538 X:17272153-17272175 GAACCTGGGTTGAAAGCATATGG - Intergenic
1187753644 X:22495766-22495788 CAGCCAAGGTTGAGAACATCTGG + Intergenic
1193708484 X:84851918-84851940 GATCGCAGGTTGAAGGCATGGGG - Intergenic
1193710868 X:84878104-84878126 GATCATAGGTTGAAGGCATGGGG + Intergenic
1195040527 X:101010012-101010034 GAACCAAGGCTGACAGCAACAGG + Exonic