ID: 1179775990

View in Genome Browser
Species Human (GRCh38)
Location 21:43662888-43662910
Sequence AAATATTGACTAAAATGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 337}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179775983_1179775990 13 Left 1179775983 21:43662852-43662874 CCATCCCTGCCTATCTTATCAGT 0: 1
1: 0
2: 2
3: 21
4: 260
Right 1179775990 21:43662888-43662910 AAATATTGACTAAAATGGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 337
1179775986_1179775990 4 Left 1179775986 21:43662861-43662883 CCTATCTTATCAGTTCTGCAACT 0: 1
1: 0
2: 1
3: 14
4: 151
Right 1179775990 21:43662888-43662910 AAATATTGACTAAAATGGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 337
1179775984_1179775990 9 Left 1179775984 21:43662856-43662878 CCCTGCCTATCTTATCAGTTCTG 0: 1
1: 0
2: 0
3: 18
4: 177
Right 1179775990 21:43662888-43662910 AAATATTGACTAAAATGGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 337
1179775985_1179775990 8 Left 1179775985 21:43662857-43662879 CCTGCCTATCTTATCAGTTCTGC 0: 1
1: 0
2: 1
3: 11
4: 131
Right 1179775990 21:43662888-43662910 AAATATTGACTAAAATGGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179775990 Original CRISPR AAATATTGACTAAAATGGGG AGG Intronic
901807061 1:11745217-11745239 CTATATTGTCTAAAAAGGGGAGG - Intronic
904104210 1:28063954-28063976 AAAAATTGTCTAAAATGTGTGGG - Intronic
905428506 1:37903368-37903390 CTATATGGTCTAAAATGGGGAGG + Intronic
906378327 1:45315079-45315101 AAATAATAAATAAACTGGGGTGG - Intergenic
908273931 1:62449616-62449638 TAAAAATGACTAAAATGGGCTGG + Intronic
908327923 1:63042111-63042133 AAATATTGACAAAACTCTGGAGG - Intergenic
908582485 1:65530543-65530565 CAATATGGTCTAAAAAGGGGAGG - Intronic
909373114 1:74909778-74909800 AAATATAGTCTGAATTGGGGTGG + Intergenic
909814861 1:79979114-79979136 AGAGATTGACCAAGATGGGGTGG + Intergenic
909842086 1:80339639-80339661 AACTATGGATTAAAATGTGGAGG + Intergenic
909854532 1:80511676-80511698 AAATAATTACTAAATGGGGGGGG + Intergenic
910298450 1:85677200-85677222 AAATATTTAAAGAAATGGGGAGG + Intronic
910892792 1:92034938-92034960 AAGTATTAACTAAAGTGGGTCGG - Intronic
911234205 1:95392554-95392576 AAGCATTGACTGAAATTGGGAGG - Intergenic
913106662 1:115620691-115620713 AAATATTAACTAAAATAAGGGGG + Intergenic
915697102 1:157754376-157754398 CAATATGGTCTAAAAAGGGGAGG + Intronic
915775609 1:158481859-158481881 AAATTTTGAGAAAAAAGGGGTGG - Intergenic
916842883 1:168617962-168617984 AAAGATGGAGTAAAATGAGGAGG + Intergenic
917127207 1:171697681-171697703 AAATCTTGACTAAAGTGTTGAGG + Intergenic
917870724 1:179239627-179239649 AAAAATTAACAAAAATGGGCTGG - Intergenic
918840894 1:189537944-189537966 AAATAGAACCTAAAATGGGGAGG + Intergenic
919966501 1:202532113-202532135 CTATATGGTCTAAAATGGGGAGG - Intronic
920572220 1:207025786-207025808 AAATATTAACTTAAAGGGGGAGG + Intronic
922132173 1:222790653-222790675 AAAAATGGATTAATATGGGGGGG + Intergenic
923311604 1:232740927-232740949 AATAATTTACTGAAATGGGGAGG + Intergenic
924495453 1:244584586-244584608 AAATATAGACTCAAAGGAGGCGG - Intronic
1063178481 10:3573294-3573316 AAACTTTGACAAAAATGGTGGGG + Intergenic
1063203830 10:3811710-3811732 AAACATTCTCTAAAATGGTGCGG + Intergenic
1064160482 10:12941256-12941278 GTATATTGTCTAAAAAGGGGAGG + Intronic
1064968781 10:21041837-21041859 ATATATGGTCTAAAGTGGGGAGG - Intronic
1065634922 10:27721921-27721943 AAATATTCAGTAAAATGTGTTGG + Intronic
1068103116 10:52581172-52581194 AGAAATTGGCTAAAATGAGGGGG + Intergenic
1068204216 10:53827831-53827853 AAATTTTAATTAAAATGGGATGG + Intronic
1070077978 10:73156738-73156760 AAATATTTACTAAGATGAAGAGG - Intronic
1072033588 10:91543831-91543853 TATTATTGACTAAAATTTGGTGG + Intergenic
1074260568 10:111849076-111849098 AGAAATTGGCTAAAATGAGGGGG - Intergenic
1074491225 10:113941318-113941340 AAATATTGACTGAAGTTGGTGGG - Intergenic
1075272645 10:121065971-121065993 AAGTATTGACAAAGATGTGGAGG - Intergenic
1077822081 11:5755565-5755587 AAATATTGGCTACAATGATGTGG - Exonic
1077967769 11:7153932-7153954 ATATATTGTCTAATATGGTGGGG + Intergenic
1080528994 11:33155633-33155655 AAATATTGAATAAAATCAGAAGG - Intronic
1080845930 11:36026785-36026807 CTATATGGTCTAAAATGGGGAGG + Intronic
1081050255 11:38331327-38331349 AAATATGGTGTAAAATGTGGTGG - Intergenic
1081465762 11:43315161-43315183 GAGTATTGACAATAATGGGGAGG - Intronic
1082096414 11:48134368-48134390 AAATATTCAATAACATGGGGAGG - Intronic
1082182392 11:49135261-49135283 AAAAAATGACTAAAATGGACAGG + Intergenic
1082282889 11:50289346-50289368 ACATATATACTAAAATTGGGGGG + Intergenic
1083911005 11:65709946-65709968 GAATATGGTCTAAAAAGGGGAGG + Intergenic
1084077610 11:66793387-66793409 AAAAATTAACAAAAATGGGCTGG - Intronic
1086388984 11:86341036-86341058 AAAAATAGATTAAAAAGGGGAGG - Intronic
1086508478 11:87529707-87529729 GAATCCTGACTAATATGGGGAGG + Intergenic
1087062942 11:93999980-94000002 AAATATTGGCTAAAATCTGTTGG - Intergenic
1087578022 11:100014357-100014379 AAAAATAGAATAAAATGGAGAGG - Intronic
1088669093 11:112123883-112123905 AAATATTGAAATAAATGGGATGG + Intronic
1089870326 11:121666864-121666886 AAATCTTGACTAATATGGTATGG + Intergenic
1093461796 12:19413704-19413726 CAATATGGTCTAAAAAGGGGAGG - Intronic
1093722895 12:22465637-22465659 AAAGAATGAGCAAAATGGGGGGG - Intronic
1094012834 12:25827101-25827123 CAAAATTCACTAAAATGGGAGGG - Intergenic
1094470025 12:30795079-30795101 GAAGATTGACTAAAAGAGGGTGG - Intergenic
1096302927 12:50447860-50447882 AAAAATAGAAAAAAATGGGGGGG - Intronic
1096905003 12:54927122-54927144 ATAAATTGACTAAAATGAGAGGG - Intergenic
1098640686 12:72835346-72835368 ATATATGGTCTAAAAAGGGGAGG - Intergenic
1099048911 12:77759667-77759689 AAATATTGACCACCATGGTGTGG + Intergenic
1099815319 12:87639130-87639152 AAATATTGAACAAGAAGGGGAGG + Intergenic
1099837776 12:87929356-87929378 GAATAGTGACTACAAAGGGGAGG + Intergenic
1101185356 12:102270793-102270815 GAAAATTAACTAAAATTGGGTGG - Intergenic
1101221944 12:102650766-102650788 TGATATTGACTAAAATGAGGTGG + Intergenic
1103354872 12:120312309-120312331 AAAGTATGGCTAAAATGGGGTGG + Intronic
1107174507 13:37384867-37384889 CAATATGGTCTAAAAAGGGGAGG + Intergenic
1107311841 13:39086756-39086778 ATATATGGTCTAAAAAGGGGAGG + Intergenic
1107465906 13:40650135-40650157 ATATATAGTCTAAAAAGGGGAGG - Intronic
1108646079 13:52429941-52429963 GAACAGTGCCTAAAATGGGGAGG + Intronic
1109162385 13:58991782-58991804 CTATATTGTCTAAAAAGGGGAGG - Intergenic
1109278923 13:60332945-60332967 AAATATTGCCCAAAGTGGAGGGG - Intergenic
1110056866 13:70985058-70985080 AGAAATTGACTAAAATGAAGGGG + Intergenic
1110871568 13:80458382-80458404 AGATATTGCCTAAAATGCAGAGG + Intergenic
1111251450 13:85606926-85606948 AAATACTGACTGGGATGGGGTGG + Intergenic
1112115806 13:96352076-96352098 AAATATTCAATAATATGAGGAGG + Intronic
1112582786 13:100690848-100690870 AAAAATTGACCAAAATGAAGGGG - Intergenic
1113449772 13:110399667-110399689 AAAAATTGTCTAAATTTGGGGGG + Intronic
1113524459 13:110963957-110963979 ACATATGGTCTAAAAAGGGGAGG + Intergenic
1113711320 13:112467180-112467202 GAAAATTGAGTAAAATGGGATGG - Intergenic
1114046543 14:18881081-18881103 AAAGACTGACTAAAATGGCAAGG + Intergenic
1114117669 14:19638367-19638389 AAAGACTGACTAAAATGGCAAGG - Intergenic
1114150090 14:20028619-20028641 GAAAATTTACTAAAATGGGCTGG - Intergenic
1117244405 14:53869911-53869933 AAATATTCACTAAAGTTGAGAGG + Intergenic
1118118248 14:62806172-62806194 CAATATGGTCTAAAAAGGGGAGG + Intronic
1118540985 14:66825163-66825185 CACTATTAACTAATATGGGGGGG + Intronic
1119599361 14:75964702-75964724 AAGTATTCACTGAAATGGGAAGG + Intronic
1120460356 14:84787108-84787130 AAAAATTGAATAACATGGGCCGG - Intergenic
1120790380 14:88575333-88575355 GAATATTGACTAATATGGTGGGG + Intronic
1122547733 14:102533717-102533739 CTATATGGTCTAAAATGGGGAGG - Intergenic
1126215761 15:46152825-46152847 AAATAATGCCTAAATTGGGAAGG - Intergenic
1126881331 15:53101351-53101373 AAATATTGATTACAAGGGGTAGG + Intergenic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1127062139 15:55197461-55197483 GCATATTAATTAAAATGGGGGGG - Intergenic
1127095882 15:55511991-55512013 AAATAATCACTAATATGGGCTGG - Intergenic
1127358668 15:58226100-58226122 AATTTCTTACTAAAATGGGGGGG - Intronic
1129982846 15:79890040-79890062 AAATATTCACAATTATGGGGTGG + Intronic
1131245470 15:90788102-90788124 AAAAAGAGATTAAAATGGGGTGG + Intronic
1132716713 16:1293957-1293979 ATATATGGTCTAAAAAGGGGAGG - Intergenic
1134095944 16:11418525-11418547 CTATATTGTCTAAAAAGGGGAGG + Intronic
1134292485 16:12913491-12913513 AAGTAATGACAAAAATGGGCTGG - Intronic
1137241864 16:46662245-46662267 AAACACGGACAAAAATGGGGAGG - Exonic
1139205380 16:65023676-65023698 ATATATGGTCTAAAAAGGGGTGG - Intronic
1141277968 16:82605248-82605270 GTATATAGTCTAAAATGGGGAGG + Intergenic
1141490145 16:84367399-84367421 AAATATTTGCTCAAAAGGGGTGG + Intergenic
1148646481 17:49222388-49222410 AAATATTAACTAAGCTGGGGAGG + Intronic
1148659772 17:49319994-49320016 AAATATAGAATTAAATGGAGAGG - Intronic
1149002577 17:51772512-51772534 AAATATTGACTAAATCCTGGAGG + Intronic
1149097259 17:52857964-52857986 AAATATTGACTAATGTGAAGTGG - Intergenic
1150511689 17:65759169-65759191 CTATATTGTCTAAAAAGGGGAGG + Intronic
1150897432 17:69229842-69229864 TAATATTCACTTAAATGGGTGGG + Intronic
1203183831 17_KI270729v1_random:92855-92877 AGAGATTGACTTAAATGGGTGGG - Intergenic
1203197417 17_KI270729v1_random:244949-244971 AAATATCGACTGAAATGGAATGG + Intergenic
1203207022 17_KI270730v1_random:45720-45742 AAATATCGACTGAAATGGAATGG + Intergenic
1153124468 18:1773900-1773922 AAATATTGTATAAAATGGCTCGG - Intergenic
1153271779 18:3329638-3329660 AAAGATTGACTGAGATGGGGAGG - Intergenic
1155756524 18:29504498-29504520 ATATATTGACAAAGATGTGGGGG + Intergenic
1155774558 18:29743591-29743613 AGATAGTAACTAAAATTGGGGGG + Intergenic
1155890047 18:31256436-31256458 AAATAGTGACTATGAAGGGGAGG - Intergenic
1157356879 18:46943560-46943582 CAATATGGTCTAAAAAGGGGAGG + Intronic
1157766772 18:50303458-50303480 ACAGGTTGACTAAAATGGGGCGG - Intergenic
1157838423 18:50930558-50930580 AATTATTGAGTTAAATGGGCAGG + Intronic
1158122687 18:54067224-54067246 AAATAATAACTAACTTGGGGGGG - Intergenic
1159168482 18:64731976-64731998 AATTTATGATTAAAATGGGGAGG - Intergenic
1160381001 18:78455767-78455789 AAATATTAACTAAGATAAGGCGG - Intergenic
1162290298 19:9774727-9774749 AAATATCGACGAAAAGGGGCAGG + Intronic
1163210978 19:15840064-15840086 ATATATGGTCTAAAAAGGGGAGG - Intergenic
1164005690 19:21146557-21146579 CTATATTGTCTAAAATTGGGAGG - Intronic
1164518642 19:28959262-28959284 CTATATTGTCTAAAATGGGAAGG + Intergenic
1166114474 19:40644943-40644965 AAGTATTCAAAAAAATGGGGAGG + Intergenic
1166459690 19:42975358-42975380 CTATATGGACTAAAAAGGGGAGG - Intronic
1166477006 19:43135404-43135426 ATATATGGACTAAAAGGGGGAGG - Intronic
925378252 2:3404360-3404382 GACTTTTGAGTAAAATGGGGAGG - Intronic
926521864 2:13925439-13925461 AAATATTGACTAATTTAAGGGGG + Intergenic
926700547 2:15800447-15800469 GAATATTCACTATACTGGGGTGG - Intergenic
926728425 2:16015738-16015760 AAATATTGACGAAAATCGTTCGG - Intergenic
927342187 2:21995110-21995132 AAATATTGACTAACTTGTTGTGG - Intergenic
927603814 2:24468064-24468086 CAAATTTGACTAAAATGGGAAGG - Intergenic
929030255 2:37643678-37643700 CAATACTAATTAAAATGGGGGGG + Exonic
929363213 2:41120109-41120131 AAATTCTGACTAATATGGTGGGG + Intergenic
929618495 2:43331085-43331107 CAATATGGTCTAAACTGGGGTGG - Intronic
930556624 2:52903868-52903890 AAATATTTTCTAAAATAGTGTGG - Intergenic
930604516 2:53479612-53479634 AAATATTGCCTAAAGTTGAGTGG - Intergenic
931386671 2:61804102-61804124 CTATATGGTCTAAAATGGGGAGG - Intergenic
931544053 2:63361206-63361228 TAAAATTGATTAAGATGGGGAGG + Intronic
931624936 2:64248867-64248889 AAATAGTCTATAAAATGGGGAGG + Intergenic
932044726 2:68336390-68336412 AAATGTTGACAAGAATGTGGAGG - Intergenic
932237088 2:70129264-70129286 AAAAATTGGTTAAAATAGGGTGG - Intergenic
933115550 2:78465520-78465542 GAATGTTGAGTAAAAAGGGGAGG - Intergenic
933429875 2:82162143-82162165 AAATATTAACTAAAAAAGGTAGG + Intergenic
933546533 2:83720315-83720337 ACATATTTATTAAAAGGGGGAGG - Intergenic
935452667 2:103228086-103228108 AAATGTTGACTAAAGTTAGGTGG - Intergenic
937409478 2:121660565-121660587 AGATATTAACAAAAATAGGGTGG - Intergenic
937434899 2:121872158-121872180 ACTGATTGACTAAAATTGGGGGG + Intergenic
938266818 2:129933822-129933844 AAAGAGTGACTAAAATGGCAAGG - Intergenic
939676738 2:145081862-145081884 GAATATTGCCTATAATGGTGAGG + Intergenic
940176953 2:150888727-150888749 AAACACTGATTAAAATGAGGTGG + Intergenic
940353266 2:152712662-152712684 AAATAAAGACTCAAATAGGGAGG + Intronic
940736469 2:157458800-157458822 AAATTTTAACAAAGATGGGGTGG - Intronic
940913447 2:159229162-159229184 AAATATGGACTAAACTAGGTAGG - Intronic
941007766 2:160265017-160265039 AAATAATTACAAAAATGGGAAGG + Intronic
941097642 2:161258210-161258232 TGATATTGAATAAATTGGGGTGG + Intergenic
941190945 2:162380971-162380993 AAATATAGACAAAAATGAGGGGG - Intronic
941313397 2:163962451-163962473 AAATATTGACAAGGATGTGGAGG + Intergenic
941584114 2:167335589-167335611 ATATATGGTCTAAAAAGGGGAGG - Intergenic
941922169 2:170862264-170862286 AAATATTGTAGAAAATGGGCTGG - Intergenic
942120786 2:172774565-172774587 AAATATCAGCTAAAATGGTGTGG + Intronic
943016545 2:182517377-182517399 AAATAGTGACTAAAACCAGGTGG - Intronic
943671458 2:190666117-190666139 AAATGTTAAATAAAATAGGGAGG - Intronic
943883270 2:193176006-193176028 AATTATTTATTAAAATTGGGTGG - Intergenic
945771550 2:214049304-214049326 AAATATTGACGGAAAAGGAGAGG - Intronic
946548276 2:220770580-220770602 ATATATAGACTAATATGGAGGGG + Intergenic
946801562 2:223422562-223422584 AAATATTTACTAAAAGAGGATGG + Intergenic
946885540 2:224218823-224218845 AAAGATTGTCAAAAATGTGGAGG + Intergenic
947158888 2:227192300-227192322 AAATATTTAATAAAATGGTAGGG - Intronic
947311683 2:228809769-228809791 TAAAATTAACTAAAAGGGGGAGG - Intergenic
1169797759 20:9483008-9483030 TCATATTGACTAAAATGAGTAGG - Intergenic
1171566613 20:26198375-26198397 AAGTAATGACTAAAATTGGTTGG - Intergenic
1173752657 20:45489100-45489122 CTATATAGACTAAAAAGGGGAGG - Intergenic
1174736530 20:52971207-52971229 TAATAGTGTCTAAAAGGGGGTGG - Intergenic
1174954722 20:55084621-55084643 CAAAATATACTAAAATGGGGTGG + Intergenic
1176291686 21:5048910-5048932 CTATATTGTCTAAAAAGGGGAGG - Intergenic
1177052934 21:16261495-16261517 CAATATTGATAAAAAGGGGGCGG - Intergenic
1179255171 21:39709689-39709711 CTATATGGTCTAAAATGGGGAGG - Intergenic
1179775990 21:43662888-43662910 AAATATTGACTAAAATGGGGAGG + Intronic
1179865569 21:44214731-44214753 CTATATTGTCTAAAAAGGGGAGG + Intergenic
1180465081 22:15603719-15603741 AAAGACTGACTAAAATGGCAAGG + Intergenic
1182190762 22:28458583-28458605 AAATATTTACCAAAATAGGCTGG + Intronic
1183129666 22:35821878-35821900 AAACTTTGACCAAAAGGGGGAGG + Intronic
1183325478 22:37189107-37189129 CTATATTGTCTAAAAGGGGGAGG - Intronic
950616772 3:14166220-14166242 CACTATTGATTAAAATAGGGAGG - Intronic
953152457 3:40337434-40337456 AAAAATTAACAAAGATGGGGTGG - Intergenic
953153981 3:40352244-40352266 ATATATGGCCTAAAAAGGGGAGG + Intergenic
953156685 3:40381660-40381682 TAAGTTTGGCTAAAATGGGGAGG + Intergenic
956966663 3:74469700-74469722 AAATGTTGGCTAGAATGTGGAGG + Intronic
957761645 3:84566474-84566496 AAATATTTACTAAAAAGGCCGGG + Intergenic
958092071 3:88889682-88889704 AAATATTCACTTAATTGTGGTGG + Intergenic
958759839 3:98293734-98293756 ATATCTTGTCCAAAATGGGGGGG - Intergenic
958859312 3:99426334-99426356 AAAGATTGAGTAAAATTGGCTGG - Intergenic
959872641 3:111346105-111346127 ATATATGGTCTAAAAAGGGGAGG - Intronic
960976189 3:123176875-123176897 AAACATAAAGTAAAATGGGGGGG + Intronic
963101660 3:141612430-141612452 AAATATTAAATACAATGTGGAGG - Exonic
964211545 3:154233875-154233897 AAATATTTACTAGAATGTGCTGG - Intronic
965763226 3:172103188-172103210 AAATATTAACTAAAAGGGAAAGG - Intronic
966382175 3:179355101-179355123 ATATATGGGCTAAAAAGGGGAGG - Intronic
967578852 3:191127691-191127713 AAATATTGACTGAAATCGAATGG - Intergenic
967669246 3:192212771-192212793 TAAAATTCACAAAAATGGGGGGG + Intronic
969270920 4:6100712-6100734 AAATGTTGACTAGCATGTGGAGG - Intronic
971978681 4:33725214-33725236 CTATATTGTCTAAAAGGGGGAGG + Intergenic
972958243 4:44419156-44419178 CAAAATTTACTAAAATTGGGTGG + Intronic
974348285 4:60710944-60710966 AAATAAAGACTAAATTGGGCAGG - Intergenic
975500849 4:75083012-75083034 GATTATTGACAAAAATGTGGTGG + Intergenic
976345075 4:83990979-83991001 ACATATTGACTAAATTTGGAAGG + Intergenic
976517017 4:85980615-85980637 AAATGAGGACTAAAATGGAGAGG - Intronic
977018341 4:91724220-91724242 AAATTTTAACTAATATGGGCAGG - Intergenic
977138050 4:93331130-93331152 AGATAATGAGTGAAATGGGGGGG - Intronic
977592733 4:98844585-98844607 CTATATTGTCTAAAAAGGGGAGG - Intergenic
980407882 4:132377305-132377327 AAATTTTAACAAAAATGGGCTGG - Intergenic
981052194 4:140320281-140320303 CTATATTGTCTAAAAAGGGGAGG + Intronic
981314340 4:143327003-143327025 AAATATGGCCCAAAATGAGGGGG + Intergenic
981362721 4:143866226-143866248 AAATATTGGGTAGAAGGGGGCGG + Intergenic
982588079 4:157268080-157268102 AAATATTAACTAAAGAGGTGGGG + Intronic
983862064 4:172719901-172719923 TAATATTGTCTAAAAAGGGGAGG - Intronic
983959445 4:173734549-173734571 AACCACTGACTCAAATGGGGGGG - Intergenic
984656763 4:182326837-182326859 CAAAATTGACTAAAATGGGCTGG - Intronic
985155028 4:186978647-186978669 TAATAATGAGTAAAATGGGCAGG + Intergenic
986615080 5:9607657-9607679 AAATATAAATTAAAATGAGGTGG - Intergenic
986665542 5:10100792-10100814 CATTATTGACTAAAACTGGGTGG + Intergenic
986803054 5:11281265-11281287 CATTATTGACTAAAATGGCTTGG + Intronic
986882493 5:12192603-12192625 AAATAATGACTAAATTATGGGGG - Intergenic
986953709 5:13124018-13124040 AAACATTGCCTAGAATGGTGAGG + Intergenic
987911192 5:24148221-24148243 AAATATTGACTCCATTGTGGAGG - Intronic
988129836 5:27089496-27089518 AAATATTGATGAAAAAGGGATGG + Intronic
988282703 5:29171070-29171092 AAATATTGAACAAAAAGTGGAGG + Intergenic
988359986 5:30224381-30224403 AAAGAATGAATAAAAAGGGGTGG + Intergenic
989042366 5:37242018-37242040 TAAGATTGAGTAAAATGGTGTGG - Intronic
989470372 5:41810258-41810280 AAATGATGACTAAAATGAGCTGG + Intronic
990076834 5:51856389-51856411 CTATATGGTCTAAAATGGGGAGG - Intergenic
990340950 5:54822456-54822478 ATATATAGTCTAAAAAGGGGAGG + Intergenic
990497958 5:56367648-56367670 AATAATTGACTAAAGTGGGCAGG - Intergenic
991136556 5:63188915-63188937 AAATATTGACAAAGGTGGAGTGG - Intergenic
992447035 5:76843549-76843571 CTATATGGTCTAAAATGGGGAGG - Intergenic
992464046 5:76986377-76986399 AAATATTGCCAAAAATGGCCAGG - Intergenic
993473351 5:88333548-88333570 AAATATTGGCAAGAATGAGGAGG - Intergenic
993717704 5:91291861-91291883 ATATATGGTCTAAAATGGGGAGG - Intergenic
994156461 5:96508835-96508857 ACTTATTAACTAAAATGGAGGGG + Intergenic
994281551 5:97909464-97909486 CTATATGGTCTAAAATGGGGAGG - Intergenic
994791863 5:104237524-104237546 AACTATTAACTAAAATGAGTAGG + Intergenic
996206676 5:120746498-120746520 AAATATTGACAAAATTGGGAAGG - Intergenic
996367624 5:122719753-122719775 CTATATGGACTAAAAAGGGGAGG + Intergenic
996491708 5:124105656-124105678 AAATAGGGACCAAAATGAGGAGG + Intergenic
996925755 5:128824238-128824260 CAATATTGTCTAAAAAGGGGAGG + Intronic
996940314 5:128997128-128997150 AAAAAGTTACTAAAATGTGGTGG - Intronic
998938468 5:147255838-147255860 AAATATTGACTTAAATCCTGCGG + Intronic
1000098205 5:157989465-157989487 AAAAATTGACTGAAATTGGTTGG - Intergenic
1000276716 5:159743469-159743491 AACTATTGATTAATTTGGGGGGG - Intergenic
1000585054 5:163087180-163087202 AATTATTGAATAAATTGGGTGGG - Intergenic
1001912613 5:175533588-175533610 AAATATAAACTAAATTGGGAAGG + Intergenic
1004909874 6:20272665-20272687 CTATATTGTCTAAAAGGGGGAGG - Intergenic
1005179434 6:23087758-23087780 CACTACTGACTAAAATTGGGAGG - Intergenic
1005313595 6:24582972-24582994 AAATTTTGACCAATATGTGGTGG + Intronic
1008292577 6:49735883-49735905 AAATATTGATAAACATGTGGAGG + Intronic
1009379844 6:63013319-63013341 AAAGAATGACTAATTTGGGGGGG + Intergenic
1009901399 6:69811842-69811864 GAAGCTTGACTAAAAAGGGGTGG + Intergenic
1011056249 6:83206473-83206495 AGATGTTGGCTAAAATGAGGTGG - Intergenic
1011070650 6:83378180-83378202 AAATAATTAATACAATGGGGGGG + Intronic
1011344268 6:86351912-86351934 TAATATTGATTAAAATTGGATGG + Intergenic
1012974409 6:105764654-105764676 AAATAATGGGTAAAATGAGGTGG - Intergenic
1013291187 6:108719963-108719985 AAATATTGAATAAAATGGCCTGG - Intergenic
1013698683 6:112735651-112735673 AAATATTAACTAGGATGTGGAGG - Intergenic
1014518618 6:122410096-122410118 AAATATTGAGAACAATGGGGAGG - Intronic
1015834001 6:137399568-137399590 AAATAATGGCTACAATGTGGTGG + Intergenic
1017249509 6:152263918-152263940 TAATAATGACGAAAATGGGCTGG + Intronic
1017835129 6:158170030-158170052 AAATATAAACTAAAAGGAGGTGG + Intronic
1018202509 6:161408834-161408856 AAATCTTATCTAAAATGAGGTGG + Intronic
1018329917 6:162716388-162716410 AAATAATAACTAATATGGGTTGG - Intronic
1018336516 6:162796595-162796617 TATTATTGACTAAAATCAGGTGG - Intronic
1019791430 7:3016448-3016470 AAGTATGGTCTAAAAAGGGGAGG + Intronic
1020988331 7:15164233-15164255 AAAAATTAACTCAGATGGGGTGG + Intergenic
1021182300 7:17520926-17520948 GAACAGTTACTAAAATGGGGAGG - Intergenic
1022289242 7:28985385-28985407 AAATACTGACTGAAAAAGGGAGG - Intergenic
1022417203 7:30188701-30188723 AAATATTGAATAATATGGTCTGG - Intergenic
1022613498 7:31902846-31902868 ATATATTGAGTGAAATGGGTAGG + Intronic
1023587519 7:41746048-41746070 CAATATGGTCTAAAATGGGGAGG - Intergenic
1024284899 7:47748567-47748589 AAATAAAGACTAAGATGAGGGGG + Intronic
1024424680 7:49212169-49212191 AGAAATTGACTAAAATGAAGTGG + Intergenic
1025868720 7:65410376-65410398 AAGTATTGACTAGGATGTGGAGG + Intergenic
1026918890 7:74140546-74140568 CTATATTGTCTAAAAAGGGGAGG + Intergenic
1027498544 7:78919043-78919065 ATATATTGACTAAATTGGACAGG + Intronic
1030002137 7:105076268-105076290 AAATATTAATCAAAAGGGGGAGG + Intronic
1030155933 7:106455705-106455727 CCATATGGTCTAAAATGGGGAGG - Intergenic
1030469987 7:109951757-109951779 AAATATAGTCTAAAAAGGGGAGG + Intergenic
1030499090 7:110336446-110336468 AGGTATGGAATAAAATGGGGTGG + Intergenic
1030691200 7:112536163-112536185 AAAAATAGACAAAAATGGGTGGG - Intergenic
1031775884 7:125908899-125908921 ATATATGGTCTAAAAAGGGGAGG + Intergenic
1032961538 7:137041120-137041142 ATATATGGTCTAAAAAGGGGAGG + Intergenic
1033161549 7:139001489-139001511 ATATATGGTCTAAAAAGGGGAGG + Intergenic
1033322839 7:140355896-140355918 AAAAATACACTAAAATGGGCTGG + Intronic
1034959691 7:155357591-155357613 AAGAAGTGACTAAAAAGGGGAGG + Exonic
1036421053 8:8595880-8595902 AAATATTAGCTAAGATGTGGAGG - Intergenic
1038268483 8:26054590-26054612 ATATTTTGAATAAAATGGGCGGG - Intergenic
1038379361 8:27077890-27077912 ACATATTAAATAAAATGGGGGGG - Intergenic
1039167032 8:34693818-34693840 AAATATTGAAGAAACTGGAGTGG - Intergenic
1039604146 8:38866981-38867003 CAATATGGTCTAAAAAGGGGAGG + Intergenic
1040009121 8:42646691-42646713 AAATATTGTATAAAATGGGCCGG + Intergenic
1041126829 8:54649925-54649947 AAATATTGACTCATATAGGATGG - Intergenic
1041540961 8:58984495-58984517 AAAAATTGACTAAAAAGGACGGG + Intronic
1041968125 8:63704709-63704731 AAATTATGCCTAAAATGGGGAGG - Intergenic
1042040393 8:64582469-64582491 AAATGTTGACTTAAGTGAGGGGG + Exonic
1042822458 8:72945488-72945510 AAAACTTGACAAAAAGGGGGAGG - Intergenic
1042968191 8:74378683-74378705 ACATAATTACCAAAATGGGGAGG + Intronic
1042975028 8:74459102-74459124 AAATATTCATAAAAATGGAGGGG + Intronic
1043186150 8:77152458-77152480 AAATAGGGACCTAAATGGGGAGG - Intergenic
1043239553 8:77915893-77915915 AAGTATAGACTAAAATGGAAAGG - Intergenic
1043262999 8:78225490-78225512 AAATATTGACCAAAATCTAGGGG + Intergenic
1043363781 8:79507431-79507453 AAAAATTAACTAAAATGGCCGGG + Intergenic
1044291073 8:90471110-90471132 AAATATTGACTCAAATTGACTGG + Intergenic
1044664608 8:94622535-94622557 AAATATTAACAAAAATAGGCTGG + Intergenic
1044935204 8:97287268-97287290 AGATATTGATTAAGATGGGGAGG - Intergenic
1044984773 8:97747846-97747868 AAATATGGTCTAGAAAGGGGAGG - Intergenic
1046920102 8:119718797-119718819 CTATATTGTCTAAAAAGGGGAGG + Intergenic
1046939289 8:119915259-119915281 AAATAATAACTAAAATAGGCTGG - Intronic
1047149234 8:122241768-122241790 AGAAATTGACTAAAATGAAGTGG - Intergenic
1047208990 8:122825559-122825581 AAACATGGACTAAAATATGGTGG - Intronic
1047680345 8:127248123-127248145 AAACATTGGCTAGAATGAGGAGG - Intergenic
1048132392 8:131712123-131712145 ACTTTTTGACTAAAATGTGGAGG - Intergenic
1050040695 9:1490175-1490197 AAATATTACCAAAAATGGGTTGG + Intergenic
1050274785 9:3985119-3985141 TAATTTTGACTGAAATGGTGAGG - Intronic
1051038765 9:12780836-12780858 GAGTATAGAGTAAAATGGGGAGG - Intronic
1052438759 9:28465572-28465594 AAATATTGGGTAAAAGAGGGCGG - Intronic
1053249063 9:36559408-36559430 CAATATGGTCTAAAAAGGGGAGG - Intergenic
1054910166 9:70447356-70447378 AAAAATTGAAGAAAATGGGAGGG + Intergenic
1055366457 9:75549524-75549546 AAATATTCACTAAAAGGGGTGGG + Intergenic
1055651026 9:78407250-78407272 AATTATTGGCCAAAGTGGGGAGG + Intergenic
1058291329 9:103244174-103244196 CAATATGGTCTAAAAAGGGGAGG - Intergenic
1059103897 9:111494888-111494910 AAATATTGACTTTCAAGGGGAGG - Intergenic
1059374030 9:113867767-113867789 AAATATTGACTAAACATGGATGG + Intergenic
1203654816 Un_KI270752v1:13390-13412 AAATATTGCCAAAAATTTGGTGG + Intergenic
1186187070 X:7031002-7031024 CTATATGGACTAAAAAGGGGAGG - Intergenic
1188968018 X:36579008-36579030 AAATAGTCACTAAATTGGGTGGG + Intergenic
1189084593 X:38008534-38008556 AAAGATTATCTAAAATAGGGAGG + Intronic
1189419749 X:40846354-40846376 CCATATTGTCTAAAAAGGGGAGG - Intergenic
1189721025 X:43917803-43917825 AATTAATCAGTAAAATGGGGTGG + Intergenic
1189777743 X:44485365-44485387 ATATATTGTCTAAAAAGAGGAGG - Intergenic
1190103436 X:47540977-47540999 AGTTAATGACTAAAATGGGCCGG - Intergenic
1190533620 X:51406110-51406132 AAATAATGACTAAAAATGAGTGG + Intergenic
1190584091 X:51920112-51920134 AAAAATTGTCTAAAATGTGTGGG - Intergenic
1193253580 X:79320862-79320884 ATATATTGATAAAAATTGGGTGG + Intergenic
1193837466 X:86362402-86362424 AAAAATTGGCTAAAATGTAGAGG + Intronic
1194383911 X:93229495-93229517 GATTATAGACTAAAATGAGGTGG + Intergenic
1194548276 X:95265455-95265477 TAATATTTTCAAAAATGGGGTGG - Intergenic
1194874716 X:99172818-99172840 AAATATTCACTTAATTGTGGTGG - Intergenic
1196106168 X:111898023-111898045 AAATATTGACAAAGATGTAGAGG - Intronic
1196530202 X:116777810-116777832 AAATTTTAAAGAAAATGGGGAGG + Intergenic
1197287629 X:124614479-124614501 AAGACTAGACTAAAATGGGGTGG + Intronic
1197464502 X:126785953-126785975 ATATATGGTCTAAAAAGGGGTGG - Intergenic
1198074426 X:133180951-133180973 AAAAAATCACTGAAATGGGGTGG - Intergenic
1198248024 X:134850176-134850198 AATTTTTGACTACAATGGGGAGG + Intronic
1201886750 Y:18893878-18893900 AAGTATTAATAAAAATGGGGAGG + Intergenic
1202302124 Y:23427911-23427933 CTATATGGTCTAAAATGGGGAGG - Intergenic
1202568687 Y:26242687-26242709 CTATATGGTCTAAAATGGGGAGG + Intergenic