ID: 1179776028

View in Genome Browser
Species Human (GRCh38)
Location 21:43663376-43663398
Sequence CGCTACTCGGGAGGGTGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97393
Summary {0: 1, 1: 111, 2: 7251, 3: 39670, 4: 50360}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179776028_1179776040 26 Left 1179776028 21:43663376-43663398 CCGCCTCACCCTCCCGAGTAGCG 0: 1
1: 111
2: 7251
3: 39670
4: 50360
Right 1179776040 21:43663425-43663447 TTTTGTGTTTTTAGTAGAGACGG 0: 7651
1: 202013
2: 142183
3: 69982
4: 56505
1179776028_1179776034 -2 Left 1179776028 21:43663376-43663398 CCGCCTCACCCTCCCGAGTAGCG 0: 1
1: 111
2: 7251
3: 39670
4: 50360
Right 1179776034 21:43663397-43663419 CGAGCGCCCACCACCACGCCTGG 0: 3
1: 110
2: 4585
3: 24578
4: 58325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179776028 Original CRISPR CGCTACTCGGGAGGGTGAGG CGG (reversed) Intronic
Too many off-targets to display for this crispr