ID: 1179776229

View in Genome Browser
Species Human (GRCh38)
Location 21:43664944-43664966
Sequence TGTAATAATCCCCACGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 2, 2: 7, 3: 28, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179776229_1179776236 0 Left 1179776229 21:43664944-43664966 CCCACCACGTGGGGATTATTACA 0: 1
1: 2
2: 7
3: 28
4: 138
Right 1179776236 21:43664967-43664989 ATTCAAGGTGAGATTTGGGTGGG 0: 1285
1: 9579
2: 10700
3: 9355
4: 7118
1179776229_1179776235 -1 Left 1179776229 21:43664944-43664966 CCCACCACGTGGGGATTATTACA 0: 1
1: 2
2: 7
3: 28
4: 138
Right 1179776235 21:43664966-43664988 AATTCAAGGTGAGATTTGGGTGG 0: 1258
1: 9618
2: 11033
3: 8774
4: 7969
1179776229_1179776233 -5 Left 1179776229 21:43664944-43664966 CCCACCACGTGGGGATTATTACA 0: 1
1: 2
2: 7
3: 28
4: 138
Right 1179776233 21:43664962-43664984 TTACAATTCAAGGTGAGATTTGG 0: 1022
1: 3742
2: 10594
3: 11678
4: 10750
1179776229_1179776234 -4 Left 1179776229 21:43664944-43664966 CCCACCACGTGGGGATTATTACA 0: 1
1: 2
2: 7
3: 28
4: 138
Right 1179776234 21:43664963-43664985 TACAATTCAAGGTGAGATTTGGG 0: 1257
1: 8964
2: 10159
3: 8288
4: 7147
1179776229_1179776237 1 Left 1179776229 21:43664944-43664966 CCCACCACGTGGGGATTATTACA 0: 1
1: 2
2: 7
3: 28
4: 138
Right 1179776237 21:43664968-43664990 TTCAAGGTGAGATTTGGGTGGGG 0: 1231
1: 9508
2: 11048
3: 8658
4: 6483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179776229 Original CRISPR TGTAATAATCCCCACGTGGT GGG (reversed) Intronic
908595096 1:65679911-65679933 TGCAATAAACCCCACTTGGTTGG - Intergenic
909702150 1:78537782-78537804 TATAATAATCCCCAAGTGCTTGG - Exonic
911734417 1:101321386-101321408 TGTAATAATTCCCACATGTCAGG + Intergenic
912480838 1:109981128-109981150 TGTAAATATCCCCATGTGGGTGG - Intergenic
913409647 1:118537145-118537167 TGTAATAATCCTCACATGTCAGG + Intergenic
917202328 1:172531288-172531310 TTTATTAATACCCCCGTGGTAGG - Intergenic
918438402 1:184541086-184541108 TGTACTAAACCCCACATAGTTGG + Intronic
1075288401 10:121207242-121207264 TGTAACCATCCCTATGTGGTAGG + Intergenic
1078249186 11:9603066-9603088 TGTAGTAATCCCCACTAGGGTGG + Intergenic
1080294822 11:30714558-30714580 AGTAATAATATCCATGTGGTAGG + Intergenic
1080691467 11:34562286-34562308 AGTAATAATCACCGAGTGGTGGG + Intergenic
1082085554 11:48046730-48046752 TGTAATAATCCACATAGGGTAGG - Intronic
1083469814 11:62876220-62876242 AGTAATAATCCTCATGTGTTAGG + Intronic
1084435317 11:69136053-69136075 TGTAATGATCCCCACATGTCAGG + Intergenic
1084487135 11:69455123-69455145 TGTAAAAATGCACACGTGATGGG - Intergenic
1087531677 11:99389746-99389768 TGGAATTTTCCCCAAGTGGTAGG + Intronic
1087946981 11:104174096-104174118 TGTAATAATCCCCACATGTCAGG - Intergenic
1088396070 11:109371105-109371127 TGGGATAATCCCCACCTCGTGGG - Intergenic
1089473242 11:118737842-118737864 TGTAATAATCCCCATGTGTCAGG + Intergenic
1095719434 12:45385023-45385045 TGGATTATTCCCCAGGTGGTGGG + Intronic
1096379583 12:51144939-51144961 TATAATAATCCCAACGTTTTGGG + Intronic
1096442103 12:51651659-51651681 TCTCATAATTCCCACGTTGTGGG - Intronic
1099544568 12:83962385-83962407 TGTAATAATCCCCACGTCAAGGG + Intergenic
1100107655 12:91196307-91196329 TGTAATCATCCCCACGTGTCAGG - Intergenic
1103763854 12:123268667-123268689 TCTCATCATCCCCACGTGGGAGG - Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1106942632 13:34794821-34794843 TGTAATAATCCCCACATGTCAGG + Intergenic
1107096242 13:36539718-36539740 TGTAATAATCCCCATGTGTCAGG + Intergenic
1108154705 13:47573461-47573483 TATTATAATCCCCACATGTTGGG + Intergenic
1109870079 13:68322380-68322402 CGTAATAATCCCCATGTAGTGGG - Intergenic
1110929424 13:81196102-81196124 TGTAATAATCCCCACAAGTCAGG - Intergenic
1111052608 13:82905060-82905082 TGTAATAATTCCCATGTGTTTGG + Intergenic
1111285672 13:86089051-86089073 TGCCATAATCCCCACGTCATGGG - Intergenic
1111307633 13:86435360-86435382 TGTAATAATCACCACATGTCAGG + Intergenic
1111553571 13:89849561-89849583 TGTAGTAATCCCCATGTGTCAGG - Intergenic
1114921778 14:27341826-27341848 TGTAATAATCCCCATGTGTTGGG + Intergenic
1114991978 14:28298833-28298855 AGTTGTAATCCCCACGTGTTGGG + Intergenic
1117052464 14:51875127-51875149 TGTAACAATCCGGACGTGGATGG + Intronic
1117854058 14:60009507-60009529 TGTAATAATCCCCACGTCATGGG - Intronic
1118201809 14:63681308-63681330 TGTAATAATCCCCACAAGCAAGG + Intergenic
1120991129 14:90378408-90378430 TGTAAAATTCACCACGTGGCTGG + Intergenic
1127244775 15:57160434-57160456 TTCCATAATCCCCACGTCGTGGG - Intronic
1127530359 15:59837628-59837650 TGTCATAATTCCCAAGAGGTAGG - Intergenic
1128341045 15:66822737-66822759 TGTGATCCTCCCCACGCGGTAGG + Intergenic
1134615029 16:15644312-15644334 TGTGTTAATCCCCACGTAATGGG - Intronic
1137414010 16:48255636-48255658 TGTAATAATTCCCATGTGTCAGG + Intronic
1138956086 16:61972032-61972054 TGTAATAATCCCCACGTGTCAGG + Intronic
1141313231 16:82935344-82935366 AATCATAATCCCCACGTGTTGGG - Intronic
1147503013 17:40984050-40984072 TGTAATAGTCCCTGCTTGGTGGG - Exonic
1147576363 17:41602057-41602079 TGTAACAATCCTAACATGGTAGG + Intergenic
1159496020 18:69206273-69206295 TGTAATCATCCCCACATAGCTGG + Intergenic
1161173855 19:2828084-2828106 TGTAATAATCCCGACGTCAAGGG - Intronic
1166252614 19:41581806-41581828 TTTAATAATCCCCACGTGTTGGG - Intronic
1167683447 19:50940563-50940585 AATCATAATCCCCACGTGTTGGG + Intergenic
1167841401 19:52124463-52124485 TGGAACACTCCCCACGTGCTGGG + Intronic
925256877 2:2498021-2498043 TGTAATAATCCCCACATGTTGGG + Intergenic
925968374 2:9087798-9087820 TATAATAATCTCCACTTTGTAGG - Intergenic
927355391 2:22167263-22167285 TGTAATAATCCCCATGTTCAAGG - Intergenic
930675187 2:54192953-54192975 TGTAATAATCCCCACGTCAAGGG - Intronic
931132957 2:59359798-59359820 AGTTATAATCCCCATGTGTTAGG + Intergenic
931661308 2:64565921-64565943 TGTAACATTGCCCAAGTGGTTGG + Intronic
932524833 2:72454085-72454107 TGTAATAATCCCCGCGTGTCAGG - Intronic
932888119 2:75565508-75565530 TGAAATCATCCTCATGTGGTAGG + Intronic
937560899 2:123223003-123223025 TATAATAATCCCCAGGTGTCAGG - Intergenic
940355840 2:152740009-152740031 TCTCATAATCCCCACGTCATGGG - Intronic
940548231 2:155117389-155117411 TGTAATAATCCCCACATCAAGGG + Intergenic
941683222 2:168421324-168421346 TGGAATAATCGCCATTTGGTGGG + Intergenic
942536163 2:176966959-176966981 TGTAGTAATCCCAAAGTGCTGGG - Intergenic
944443789 2:199769274-199769296 TGTAATTATCCCCACATGTCAGG + Intronic
948008972 2:234635598-234635620 TGTAATAATCCCCATGTGTCAGG + Intergenic
948860294 2:240749682-240749704 TGTAATGCTCCCCACCTGATAGG - Intronic
1177240353 21:18447557-18447579 TCTGATAATCCCCACATGTTTGG + Intronic
1178115790 21:29415073-29415095 TGGAATACTTCCCATGTGGTGGG + Intronic
1178454337 21:32733438-32733460 TGTAATAATCCCCACATCAAGGG + Intergenic
1179776229 21:43664944-43664966 TGTAATAATCCCCACGTGGTGGG - Intronic
1180152856 21:45960772-45960794 TCCCATAATCCCCACGTTGTGGG - Intergenic
1181527630 22:23499249-23499271 TGTTTTTATCCCCACCTGGTGGG + Intergenic
950293372 3:11805887-11805909 TGTAATAATCCCCACGTCGTGGG + Intronic
951360348 3:21717601-21717623 TCTCATAATTCCCACGTGGAGGG + Intronic
954325829 3:49863097-49863119 TGTAAGAGTCACCAGGTGGTTGG - Intronic
956919236 3:73908949-73908971 TGTCATAATCCCCATGTGTTGGG + Intergenic
957166125 3:76676169-76676191 AATTATAATCCCCACGTGTTGGG + Intronic
958160975 3:89816532-89816554 TGTAATAATCCCCATGTCAAGGG - Intergenic
959383834 3:105676753-105676775 AGTTGTAATCCCCACGTGTTAGG + Intronic
960954210 3:123020189-123020211 TTTAACAAACCCCCCGTGGTTGG - Intronic
963671732 3:148259300-148259322 TGTTGTAATCTCCACGTGTTGGG + Intergenic
963778131 3:149460811-149460833 TATAATAATCCCTACCTGGCTGG + Intergenic
964025980 3:152074824-152074846 TGTAATAATCCTCACATGTCAGG - Intergenic
966823609 3:183944890-183944912 TATAATAATCCCCATGTGTGAGG + Intronic
967611742 3:191514526-191514548 AGTGATTATCTCCACGTGGTAGG - Intergenic
972880453 4:43416669-43416691 TCCCATAATCCCCACGTGTTGGG - Intergenic
974484944 4:62493239-62493261 TGTAGTAATCCCCACGTGTCAGG + Intergenic
974561489 4:63527900-63527922 TGTAATAATCCCTATGAGTTAGG + Intergenic
975874859 4:78824557-78824579 TGTAATAATCCCCACGTCAAGGG - Intronic
976135124 4:81927397-81927419 TGTTATGATCCCCATGTGTTGGG - Intronic
977952994 4:102994901-102994923 TGTAATAATCCCCATGTGTCAGG - Intronic
978298118 4:107233002-107233024 TGTAATAATCACATCATGGTAGG - Intronic
979792806 4:124807090-124807112 TCTCATAATCCCCACGTCATGGG - Intergenic
986864915 5:11974779-11974801 TGTAATAATCTCCAAGTGTCGGG - Intergenic
987707999 5:21479667-21479689 TGTAATTATCTCCATCTGGTAGG - Intergenic
988524646 5:31976507-31976529 TGTAAACATCCCCTTGTGGTTGG + Intronic
988751782 5:34195288-34195310 TGTAATCATCTCCATCTGGTAGG + Intergenic
989066573 5:37468404-37468426 TGTAATTATCTCCATGTGGTAGG - Intronic
990859663 5:60312682-60312704 TGTCATAATCCCCACGTCAAGGG - Intronic
991243999 5:64489774-64489796 TGTAATAATCCCCATGTGTCAGG - Intergenic
991465664 5:66909756-66909778 TGTAAAAATCCCCACGTCAAAGG + Intronic
991737109 5:69638062-69638084 TGTAATTATCTCCATCTGGTAGG + Intergenic
991739545 5:69656095-69656117 TGTAATTATCTCCATCTGGTAGG + Intergenic
991757957 5:69897084-69897106 TGTAATTATCTCCATCTGGTAGG - Intergenic
991788683 5:70217786-70217808 TGTAATTATCTCCATCTGGTAGG + Intergenic
991791120 5:70235836-70235858 TGTAATTATCTCCATCTGGTAGG + Intergenic
991813433 5:70492891-70492913 TGTAATTATCTCCATCTGGTAGG + Intergenic
991816565 5:70514172-70514194 TGTAATTATCTCCATCTGGTAGG + Intergenic
991819005 5:70532213-70532235 TGTAATTATCTCCATCTGGTAGG + Intergenic
991837360 5:70772966-70772988 TGTAATTATCTCCATCTGGTAGG - Intergenic
991881129 5:71218150-71218172 TGTAATTATCTCCATCTGGTAGG + Intergenic
991883566 5:71236171-71236193 TGTAATTATCTCCATCTGGTAGG + Intergenic
994420069 5:99520636-99520658 TGTAATTATCTCCATCTGGTAGG - Intergenic
994487139 5:100394503-100394525 TGTAATTATCTCCATCTGGTAGG + Intergenic
995370294 5:111410418-111410440 TGTAATAATCCCCTTGTGTCAGG - Intronic
995458012 5:112372379-112372401 TGTAATAATCCCCATGTCAAGGG - Intronic
996033270 5:118730430-118730452 TGTAATAATCCCCACATGTCAGG - Intergenic
996164181 5:120205033-120205055 TGTAATAATCCCCAAGGGCAGGG - Intergenic
996595355 5:125195425-125195447 AATGATAATCCCCACATGGTAGG - Intergenic
997606709 5:135180105-135180127 TGTAATTATTCCCACTTTGTAGG + Intronic
998660488 5:144231602-144231624 TGTAATAATCCCCATGTATCAGG + Intronic
1002211820 5:177604051-177604073 TGTACTAATTCCCAGGTGCTTGG + Intronic
1002832313 6:834013-834035 TCTCATAATCCCCACGTCATGGG + Intergenic
1003743634 6:8973154-8973176 TTTAAAAATCCCTTCGTGGTGGG - Intergenic
1004718748 6:18245817-18245839 TGTAATAATCCCCACGTTGTGGG + Intronic
1005549942 6:26901973-26901995 TGTAATTATCTCCATCTGGTAGG + Intergenic
1007343286 6:41207693-41207715 TCTCATAATCCCCATGTGTTGGG - Intergenic
1009020204 6:57940871-57940893 TGTAATTATCTCCATCTGGTAGG + Intergenic
1009726673 6:67543787-67543809 TCTCATAATCCCCACGTGTCAGG + Intergenic
1012009898 6:93770271-93770293 TGTGATATTCCCCTTGTGGTGGG - Intergenic
1013724006 6:113069863-113069885 TCCCATAATCCCCACGTGTTGGG - Intergenic
1015490422 6:133818547-133818569 CCTCATAATCCCCACGTGGTAGG - Intergenic
1015744142 6:136491775-136491797 TGTAATCCTGCCCACGTGATTGG + Intronic
1016155005 6:140795103-140795125 AGTTGTAATCCCCACGTGTTGGG - Intergenic
1016371412 6:143378102-143378124 TGCAATAATCCCCACGTCAAGGG + Intergenic
1017216485 6:151913226-151913248 GGTGAAAATCCGCACGTGGTGGG - Intronic
1019893698 7:3966535-3966557 TGTCATGATCCCCAAGTGCTGGG - Intronic
1023057464 7:36301612-36301634 TGTAAAAATGCCCTTGTGGTGGG + Intergenic
1024056866 7:45665373-45665395 TGTCATGTTCCCCACCTGGTGGG - Intronic
1027661044 7:80988434-80988456 TCCCATAATCCCCACGTCGTGGG - Intergenic
1028734932 7:94198045-94198067 TGTAATAATCCTCACATGTCAGG + Intergenic
1029026601 7:97423415-97423437 TTTAATAAACCCCACGTGTCAGG + Intergenic
1035918626 8:3652728-3652750 TGTAATAATCCCCACTTGTTAGG - Intronic
1036525719 8:9532655-9532677 TGTAATAATCCCCACGTCAAGGG - Intergenic
1037212262 8:16405103-16405125 TGTGACAATCCCCAGATGGTAGG + Intronic
1039911226 8:41828552-41828574 AGTAATAAACAGCACGTGGTTGG - Intronic
1041066735 8:54089861-54089883 TGTAATAATCCCCATGTGTAGGG + Intronic
1044648458 8:94469253-94469275 TGTAATAATCCCCATGTCAAGGG + Intronic
1045008982 8:97941469-97941491 CTTAATAATACCCATGTGGTGGG - Intronic
1047335775 8:123934742-123934764 AATTATAATCCCCACGTGTTGGG + Intronic
1047572989 8:126121450-126121472 TCACATAATCCCCACGTGTTAGG - Intergenic
1048525946 8:135202666-135202688 TGAAATAAAACCCACGTGCTTGG - Intergenic
1051017102 9:12491707-12491729 AGTAATAATCCCCATGTGTAAGG + Intergenic
1052635490 9:31098328-31098350 TGTAATAATCCCCATGTGTCGGG - Intergenic
1053640919 9:40078978-40079000 TTTAATAATGCCTACGTGTTTGG - Intergenic
1053765218 9:41386494-41386516 TTTAATAATGCCTACGTGTTTGG + Intergenic
1054543832 9:66297653-66297675 TTTAATAATGCCTACGTGTTTGG + Intergenic
1055060369 9:72062443-72062465 TTTAATAATCCCCTCGTGTTTGG + Intronic
1060986689 9:127824125-127824147 TTTAATTCTCACCACGTGGTAGG + Intronic
1189272901 X:39764263-39764285 AATAATAGTCCCCACTTGGTCGG + Intergenic
1192841733 X:74864433-74864455 TCTCATAATCCCCATGTGGGAGG + Intronic
1196313662 X:114197689-114197711 TGTAGTAATCCCCACATGTCAGG - Intergenic
1196405613 X:115359628-115359650 TCCCATAATCCCCACGTCGTGGG + Intergenic
1196589528 X:117470063-117470085 TGTAATAATCCCCACATGTCAGG + Intergenic
1198220897 X:134600840-134600862 TATAATTATCCCTACGTTGTGGG - Intronic
1198629140 X:138615986-138616008 TGTAATAATCCCCATGTGTCAGG - Intergenic
1198966999 X:142237765-142237787 TGTAATAACCCCCACGTGTGTGG + Intergenic
1199137577 X:144271074-144271096 AATTATAATCCCCACGTGTTGGG - Intergenic
1199400821 X:147396245-147396267 TCTCATAATCCCCACGTCATGGG + Intergenic
1199546485 X:149011836-149011858 TGTATTAATGGCCAGGTGGTGGG - Intergenic
1199783793 X:151085810-151085832 TGTAATAATCCCCACGTGTCAGG + Intergenic