ID: 1179776915

View in Genome Browser
Species Human (GRCh38)
Location 21:43670567-43670589
Sequence TGCCTCTGTAGAGGGAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 332}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179776911_1179776915 -3 Left 1179776911 21:43670547-43670569 CCATGAAAGTAGATCCGATCTGC 0: 1
1: 0
2: 0
3: 1
4: 46
Right 1179776915 21:43670567-43670589 TGCCTCTGTAGAGGGAGAGCAGG 0: 1
1: 0
2: 2
3: 28
4: 332
1179776910_1179776915 -2 Left 1179776910 21:43670546-43670568 CCCATGAAAGTAGATCCGATCTG 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1179776915 21:43670567-43670589 TGCCTCTGTAGAGGGAGAGCAGG 0: 1
1: 0
2: 2
3: 28
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179776915 Original CRISPR TGCCTCTGTAGAGGGAGAGC AGG Intronic
901017314 1:6239333-6239355 TTCCTCTGTGGCGGGAAAGCAGG - Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902985063 1:20149950-20149972 TGTCGCTGGGGAGGGAGAGCCGG + Exonic
903692703 1:25185537-25185559 TGCTTCTGTGGAGCGAGAGGTGG - Intergenic
904769890 1:32875131-32875153 TGTTTCTGTGGAGGGAAAGCAGG + Intergenic
904788083 1:32997534-32997556 TGCCTCTGAATAGGGAGAGTGGG + Intergenic
905210810 1:36372933-36372955 TGCCTTTGTGGATGGAGAGCAGG - Intronic
906025493 1:42670257-42670279 AGCCATTGAAGAGGGAGAGCAGG - Intronic
906695904 1:47823406-47823428 TGCCTCTGTAGAATGGCAGCTGG - Intronic
907699559 1:56771485-56771507 TGCCTCTGCAAAGGGAGAAAGGG + Intronic
907906993 1:58791482-58791504 TGACTCTGAAAAGTGAGAGCCGG + Intergenic
909501942 1:76344639-76344661 TGCCCCTGGAGAGGGAGATATGG + Intronic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
915089887 1:153416908-153416930 TCCCTCTGTGGGGGCAGAGCTGG - Intronic
915489280 1:156242443-156242465 TGCCCTTGCAGAGGGAGAGGAGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915939422 1:160109418-160109440 TGCCTCTTGATAGGGGGAGCGGG + Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
916599376 1:166276998-166277020 TGGCTGTGTAGAGGAATAGCTGG + Intergenic
917516923 1:175715882-175715904 TGTTTCTGGCGAGGGAGAGCTGG + Intronic
919978162 1:202626240-202626262 TGCCACTGCAGAGGGAGGGTGGG - Intronic
921828851 1:219704318-219704340 GGCCTGTGGAGAGGGAGAGAGGG - Intronic
1062909167 10:1201250-1201272 TGCATTTGCAGAGGGAGAGAGGG - Intronic
1063372533 10:5531212-5531234 GGCATCTGCAGAGGGAGTGCTGG + Intergenic
1066220777 10:33335208-33335230 TGCACCCCTAGAGGGAGAGCTGG + Intronic
1067455623 10:46417443-46417465 TGCCTCTGGAGAGTGAGGCCAGG + Intergenic
1067631580 10:47967196-47967218 TGCCTCTGGAGAGTGAGGCCAGG - Intergenic
1070640219 10:78162986-78163008 TGACTCTGTAGAAGGGGAGTAGG + Intergenic
1071113891 10:82194494-82194516 TTCCTCTGTAATGGGAGAGAAGG + Intronic
1073070176 10:100788359-100788381 TGCCCCTCCAGAAGGAGAGCCGG - Intronic
1073571560 10:104584735-104584757 TTCCTCTGTTGAGGGAGACGTGG + Intergenic
1074193086 10:111154994-111155016 AGCCTCTGTATCTGGAGAGCCGG + Intergenic
1074383002 10:112995426-112995448 AGCCTCTGTCCAGAGAGAGCAGG - Intronic
1074448201 10:113537771-113537793 TGCCTGGGTTGAGGGAGGGCAGG - Intergenic
1074669038 10:115766650-115766672 TTCCACTGTAGAGGGAAGGCGGG + Intronic
1075224720 10:120617970-120617992 TGGCTGTGTACAGGGAGAGAGGG + Intergenic
1075703203 10:124482705-124482727 TGCTTCTGTGCAGGGAGAGGAGG - Intronic
1077014438 11:393504-393526 GGCCTCTGTAGGGGGTGAGGGGG + Intronic
1077648106 11:3944450-3944472 TGCCTGTGTAGTGGGAGTGGAGG + Intronic
1077827997 11:5831429-5831451 GGCCTCTGTAGGGGAAGAGGGGG + Intronic
1078527573 11:12111841-12111863 TGCCACTGGGGAGGGGGAGCAGG - Intronic
1079386076 11:19981034-19981056 TGCGCATGTAGAGGGAGGGCAGG - Intronic
1079440722 11:20512167-20512189 TTTCTCTGTAAAGGGACAGCTGG - Intergenic
1080936717 11:36871257-36871279 AGCCTCAGGAGAGGGAGAGATGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082773961 11:57231501-57231523 TGTTTCAGAAGAGGGAGAGCAGG + Intergenic
1083784159 11:64934258-64934280 TGTCTGTGTAGAGGGTGAGCTGG - Exonic
1084653736 11:70503455-70503477 GGCCTCTGGAGCGGGAGAGCAGG - Intronic
1085295812 11:75431035-75431057 GGGGTCTGTAGCGGGAGAGCAGG + Intergenic
1085534050 11:77207570-77207592 TGCCTCAGAAGAGAGAGAGCTGG - Intronic
1087917257 11:103825363-103825385 TGTCTCTGCAGAAGGAGAACAGG + Intergenic
1089461275 11:118655776-118655798 AGCCTCTGTAGAGGGCAGGCTGG - Intronic
1091075271 11:132609619-132609641 TGACTCTTTAAAGGAAGAGCAGG - Intronic
1091194618 11:133720295-133720317 TGCATCTGTTGGGGGAGAGAAGG + Intergenic
1091784648 12:3235813-3235835 TGCCTGTGTGGGGGGACAGCAGG + Intronic
1091835793 12:3584629-3584651 TGCCTCTGAAGAGTGGGAGTGGG - Intronic
1092820692 12:12350623-12350645 TGCCTCTGAGGAGGGAGACTAGG - Intergenic
1094055624 12:26266754-26266776 TGCCTCTTTGGAGGGAGATGTGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097691522 12:62738847-62738869 TGCCTCTGCACTGGGAGAGAGGG - Intronic
1097966805 12:65590258-65590280 TGCCTCTGGAGAAGGTGTGCTGG - Intergenic
1097994338 12:65871291-65871313 TGCCACTGTAGTAGGAAAGCAGG - Intronic
1098376255 12:69818810-69818832 TACCTCTGGAGAGGTAGAGGAGG + Exonic
1102151552 12:110691780-110691802 TGCCTCTGTAGGGGAAGGGATGG - Intronic
1102397769 12:112602026-112602048 TCCCTCTGCAGAGGCAGAGGTGG + Intronic
1102533107 12:113561476-113561498 TTCAGCTGTAGAGGGAGAGGAGG + Intergenic
1103904240 12:124319323-124319345 AGTCTCTGTAGAAGGAGACCTGG - Intergenic
1105005947 12:132720708-132720730 TGCCATTATTGAGGGAGAGCCGG - Exonic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1110601386 13:77378220-77378242 AGGCTCTGTAGAGAGAGAGTTGG - Intergenic
1110895612 13:80748316-80748338 TGCTTCTGTACAGGGAGGTCAGG + Intergenic
1111279710 13:86005360-86005382 TACTTCTGTAGCTGGAGAGCTGG + Intergenic
1112156450 13:96822608-96822630 TGCTTCCCTAGAGGGAGAGATGG - Intronic
1113233954 13:108248400-108248422 TTCCTCTGTGGAGGGAGGGAGGG + Intergenic
1113468921 13:110530742-110530764 TGTCTGTGTAGAGGTGGAGCGGG - Intronic
1113634620 13:111911047-111911069 TGCCTCTGGAGAGAAAGAGTTGG + Intergenic
1113987242 13:114328036-114328058 TGCCTCACTTGAGGGAGTGCTGG + Intergenic
1114317978 14:21524927-21524949 TGCCCCTGAAGAGGAAGAGGAGG + Exonic
1115437371 14:33390562-33390584 TGCTTCTGTAGAGAGAGATGAGG + Intronic
1119267508 14:73272116-73272138 TGCCTCTGGATTGGGAGAGCAGG - Intronic
1119503115 14:75147806-75147828 GGGTTCTGTAGAGGGAGGGCGGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1124249891 15:28099605-28099627 CGCCTCTTTAGAGGTAAAGCTGG - Intergenic
1124493789 15:30174180-30174202 TGCCGCTGCAGAGGGAGGGTGGG - Intergenic
1124749779 15:32364469-32364491 TGCCGCTGCAGAGGGAGGGTGGG + Intergenic
1125510934 15:40291920-40291942 GGCTTCTGTGTAGGGAGAGCAGG + Exonic
1128113743 15:65092892-65092914 TGCCTCTGCAGAGGGGCAGATGG - Exonic
1128889436 15:71317702-71317724 TGCCTGTGTAGGGGGACAGTGGG + Intronic
1129007610 15:72387302-72387324 TGCCTCTGGAGAGGGATATTGGG + Intergenic
1129190704 15:73935913-73935935 TGCCTCTGCATAGGTAGAGCTGG + Intronic
1129641276 15:77381053-77381075 TCTCTGTGAAGAGGGAGAGCAGG - Intronic
1131714969 15:95098836-95098858 AACCTCTTTAGAGGGAGAGAAGG + Intergenic
1131960903 15:97789288-97789310 TGACTTTCTAGAGGGAGAGGAGG + Intergenic
1133634700 16:7653984-7654006 TGCCTCTGGGGAGGGAGGGCTGG - Intronic
1134638492 16:15810646-15810668 TGCCTCTGCAGAGAAACAGCTGG + Intronic
1135351481 16:21733065-21733087 TGCCTCTGAAGAGGGAGGCTAGG - Intronic
1135449963 16:22549193-22549215 TGCCTCTGAAGAGGGAGGCTAGG - Intergenic
1135605654 16:23822085-23822107 AGCCTCTGTGGAGGGCAAGCTGG + Intergenic
1136398290 16:30004809-30004831 TGCCGCAGAAGAGGGAGAGGAGG + Intronic
1140051397 16:71484482-71484504 TGCCTCAGTGGAGGGAGACAGGG - Intronic
1140082490 16:71761948-71761970 AGCCTCTTTAGAGGGAAATCTGG + Intronic
1141707477 16:85675298-85675320 TCCCTCTGCAGAGGGACAGATGG - Exonic
1142239877 16:88940369-88940391 AGCCTCTGTGGAGGGACAGATGG - Intronic
1142419529 16:89961888-89961910 TCCCCCTGGGGAGGGAGAGCAGG + Intronic
1142676757 17:1518252-1518274 TGCCTCTGTAGGAGGGGTGCTGG - Exonic
1142756547 17:2019659-2019681 TGGCTCTGTTGATGGAGACCAGG - Intronic
1142867524 17:2799766-2799788 TGCCTCTGGAGAGGGAGGAGGGG + Intronic
1144244934 17:13353413-13353435 TTCTTCTGTAGAGGCAGTGCTGG - Intergenic
1144760849 17:17706483-17706505 TGGGTCTGAAGAGGAAGAGCAGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145982177 17:29019485-29019507 TGCCTCTGGGGAGGGGAAGCTGG - Intronic
1146387349 17:32389070-32389092 TCCCTCTCTTGAGGGGGAGCTGG - Intergenic
1146549787 17:33770323-33770345 TTCCTCTGTAAAGCGAAAGCTGG + Intronic
1146929068 17:36765213-36765235 TGCCTCCTTAGAAGCAGAGCTGG + Intergenic
1147438744 17:40433842-40433864 TGCCTCTGGAGGTGGGGAGCGGG + Intergenic
1147585913 17:41654022-41654044 TGCCTCTGCAGTTGGAGAGCTGG - Intergenic
1147813258 17:43188856-43188878 TACTTCTGTAGAAGGGGAGCAGG + Intronic
1148116088 17:45175937-45175959 TGCTGCTGTAGAGGGAGCACTGG + Intergenic
1148451025 17:47778022-47778044 AGCCTCTGTAGCTGGAGAGGAGG - Intergenic
1148877278 17:50697291-50697313 TGCCCCAGCAGAGGCAGAGCTGG - Intronic
1149403147 17:56319558-56319580 TGCCTTTGTATAGGGATATCTGG - Intronic
1150437360 17:65164409-65164431 TGCCTGAGAAGAGGGACAGCTGG + Intronic
1150835450 17:68559721-68559743 TGCCTCTGGAGATGGGAAGCGGG - Intronic
1151214052 17:72565495-72565517 TGCTTCTGTAAAGGGAGAGAGGG - Intergenic
1151599290 17:75096434-75096456 TGCCCCTGTAGAGGGGGAGGTGG - Intronic
1151670203 17:75568126-75568148 TGCATCTGAGCAGGGAGAGCAGG + Intronic
1151904661 17:77039820-77039842 TGGCTCTGCAGAGAAAGAGCAGG - Intergenic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1152038660 17:77889294-77889316 TGGCTGTGCAGAGGGAGAGAAGG - Intergenic
1153726666 18:7963672-7963694 TGGCTCATTAGAGGGACAGCAGG - Intronic
1153904249 18:9646958-9646980 TGGCTATGGAGAGGGAGGGCTGG + Intergenic
1154083586 18:11280854-11280876 TGCATCTGCAGAGGAAGTGCGGG + Intergenic
1155052305 18:22159203-22159225 TGCCACTGTAGAGAGAAATCAGG - Intergenic
1157399896 18:47378596-47378618 TGTCTTTGGAGAGGGAGAGGAGG - Intergenic
1157597110 18:48870692-48870714 GGCCTCTGTGCAGGGAGAGCTGG + Intergenic
1157614615 18:48979085-48979107 GGCCTCTGTGCAGGGAGAGCTGG - Intergenic
1157839176 18:50939238-50939260 TGCCTCTGTAGAGCAAGAAGTGG + Intronic
1160432432 18:78821023-78821045 TGCCTGTGTACAGGGGGTGCTGG - Intergenic
1160671779 19:368465-368487 TGCCTCTGGGGAGGGAGGGAGGG + Intronic
1161751489 19:6100516-6100538 TGCCTCTGTAACAGGAGAGGAGG + Intronic
1162193097 19:8962523-8962545 TGCTTGAGAAGAGGGAGAGCTGG + Exonic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163790229 19:19302098-19302120 TGCCTGTGGGGAGGCAGAGCTGG + Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164650372 19:29886952-29886974 TGTATCTGTAGCTGGAGAGCAGG - Intergenic
1165524558 19:36342739-36342761 TTCCTCTGGGGAGGGAGACCTGG + Intronic
1166425376 19:42673520-42673542 TGCCTCTGCAGAGGGAAACCAGG - Intronic
1166721947 19:45001890-45001912 TCCCGCTGTAGAGTGAGAGGGGG + Intronic
1166957972 19:46478446-46478468 TGGCTCTTTAATGGGAGAGCAGG - Intergenic
1167676240 19:50887870-50887892 AGCATCTGCAGAGGGAGTGCTGG + Intergenic
1168142880 19:54401017-54401039 TTCCTCTGTGGAGGGAAAGGTGG - Intergenic
925013346 2:502970-502992 GGCGTCTGAAGAGGAAGAGCTGG + Intergenic
925646128 2:6038600-6038622 TGCCTTTGAAGAGTGAGAGAAGG - Intergenic
926419187 2:12680656-12680678 TGACTGTGTGGAGGGAGAACAGG - Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
928134878 2:28680698-28680720 TTCCTCTCCAGTGGGAGAGCAGG + Intergenic
928841485 2:35611011-35611033 TCCAACTGTAGAGGGAGAGTTGG - Intergenic
929024393 2:37585675-37585697 CACATCTGTAAAGGGAGAGCAGG + Intergenic
931116287 2:59170230-59170252 TGAGTCTGAGGAGGGAGAGCAGG + Intergenic
932404017 2:71501791-71501813 TGCCTCTGTTGATGGAGACTTGG + Intronic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
933704263 2:85277994-85278016 TGCCTCTGTACAGGGCATGCTGG + Intronic
934761670 2:96860081-96860103 TGCCCCTTCAGAGGGAGTGCAGG - Exonic
936519606 2:113203254-113203276 TGCCTCTGTAAACTGAGAGCAGG - Intronic
940340194 2:152572167-152572189 GGCCTTTTTAGATGGAGAGCTGG - Intronic
941175280 2:162190774-162190796 GGTCTCTGAAGAGAGAGAGCTGG + Intronic
942220113 2:173760521-173760543 TGCCTTTGTAGAAGGAAAGATGG - Intergenic
945044626 2:205770919-205770941 GGCCTCTGTAGCAGGAGAGGTGG - Intronic
945185273 2:207133727-207133749 TGCCTCTTAAGAGGGGGAGGGGG + Intronic
947531956 2:230914939-230914961 TGACTCTGTGGAAGGAGAGAGGG + Intronic
947867641 2:233410873-233410895 TGCCTGTGAAGAGGCAGAGAAGG - Intronic
948632813 2:239312873-239312895 TTCATCTGCAGAGGGAGACCGGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168954531 20:1825860-1825882 TAGCTTTGTAGAGGGAGGGCAGG + Intergenic
1171044614 20:21798179-21798201 GGCTGCTGTGGAGGGAGAGCAGG + Intergenic
1172005362 20:31815826-31815848 TGCCCCTGTAGAGGCAAAGAGGG + Intergenic
1172096779 20:32464288-32464310 TGCCTTTCTGGAGGAAGAGCTGG - Intronic
1172853478 20:37983432-37983454 GGCCTCTGTGGTGGGGGAGCAGG + Exonic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1173970536 20:47148869-47148891 TGCCACTGTCGAGTCAGAGCTGG + Intronic
1174106617 20:48166734-48166756 TCCCTCTGTGGAGTGAGATCAGG + Intergenic
1174269058 20:49353736-49353758 TGCCTCTGCAGAGGGAAACTGGG + Intergenic
1174782439 20:53402207-53402229 TTCCCCTGTAGTGGGAGTGCTGG + Intronic
1175402204 20:58707211-58707233 TGCCCCTGCAGAGGGCGGGCAGG - Intronic
1176764691 21:13004824-13004846 TACATCTGTAGAGGGAAAGAGGG + Intergenic
1176991072 21:15496826-15496848 TGACTATATAGAGGGAGAGCTGG - Intergenic
1178147359 21:29755608-29755630 TGCCTCTTTACATGGAGAGATGG + Intronic
1179776915 21:43670567-43670589 TGCCTCTGTAGAGGGAGAGCAGG + Intronic
1180751298 22:18126340-18126362 AGCATCTGTCTAGGGAGAGCAGG - Exonic
1181941562 22:26481736-26481758 TGCCTCTGTGGAGGTAGAGGTGG + Exonic
1182215300 22:28711992-28712014 TGCCTGTGGAGAGGTAAAGCTGG - Exonic
1183476722 22:38039648-38039670 CGCCTCTGTGGAGGCAGGGCTGG - Intronic
1183623723 22:38989348-38989370 TGCCTCAGTATATGGGGAGCAGG + Intronic
1184584908 22:45441416-45441438 CGCTTCTGCAGAGGGAGACCCGG - Intergenic
950676432 3:14556907-14556929 TGCCTTGGTAGAGAGAGGGCAGG - Intergenic
952865651 3:37853602-37853624 GGCCTGGGTAGAGAGAGAGCTGG - Intergenic
952971695 3:38655010-38655032 TGTGTCTGCAGAGGGAAAGCTGG - Intergenic
953079513 3:39602743-39602765 TGGCTTTGTTGAGGGTGAGCAGG - Intergenic
953547072 3:43871523-43871545 TGCCTGTGTGCATGGAGAGCTGG - Intergenic
953618368 3:44511760-44511782 CGTCCCTGTAGAGGGAGAGTTGG + Intergenic
953633922 3:44645601-44645623 TCCCTCTGAATAGGGAAAGCAGG - Intronic
954043338 3:47907303-47907325 TTGCTCTGGAGAGGGAAAGCTGG + Intronic
954677937 3:52325893-52325915 TGGCTCTGGACAGGGAGAGCAGG + Intronic
954794463 3:53154521-53154543 TACCTCTCTGGAGGGAGAGCTGG - Intergenic
955378321 3:58416578-58416600 GGCCTCTGCAGAGTGAGAGCAGG + Intronic
955836476 3:63061135-63061157 TGCAACAGTAGAGGCAGAGCAGG + Intergenic
956108760 3:65849892-65849914 TGAATCTAGAGAGGGAGAGCTGG - Intronic
956176375 3:66477009-66477031 TACGTCTGTTGAGTGAGAGCAGG + Intronic
956491590 3:69778050-69778072 TGCCTGTGGAGATGGAGAGGAGG + Intronic
956503512 3:69912262-69912284 TGCCTCTGGGGAGGGAGAGCAGG + Intronic
957841288 3:85673180-85673202 TGCCTGTGTATAGGGACAGAAGG + Intronic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
960146753 3:114211990-114212012 TGCCTCTGTTCAGTGACAGCTGG - Intergenic
960629115 3:119711254-119711276 TTGCTCTGTCTAGGGAGAGCAGG - Intronic
961469571 3:127102849-127102871 GGCCTCTGTAGACAGAGAACTGG + Intergenic
961740961 3:129032943-129032965 TGCCTCTGCAGCTGGAGAGCCGG - Exonic
963035213 3:141019818-141019840 AGGCTCTGCACAGGGAGAGCTGG + Intergenic
964669332 3:159208319-159208341 TCCCTCTGTCGAGAGAGACCAGG + Intronic
966356122 3:179080462-179080484 TGCCTCTGCTGAGGCAGAGATGG - Intergenic
966559002 3:181297858-181297880 TGCCTGTGTGGAGGGAGGGCAGG - Intergenic
967817395 3:193810984-193811006 TTCCTCTGTAGAGGCAAATCAGG - Intergenic
971267957 4:25111325-25111347 TGCTTCTGAAAGGGGAGAGCAGG + Intergenic
973758200 4:54095220-54095242 GGCCTTTCTAGAGGGAGGGCAGG - Intronic
976204955 4:82615997-82616019 TACCTCTGCGGAAGGAGAGCGGG - Intergenic
977681075 4:99799113-99799135 TGCCTTGTTAGAGGGAGACCAGG + Intergenic
977945651 4:102911028-102911050 TGCCTTTGTCAAAGGAGAGCAGG + Intronic
978165459 4:105601681-105601703 TGCCTGTGTGTAGGCAGAGCAGG + Intronic
981331522 4:143514675-143514697 TGCTTCTGTGAAGGGAGAGAAGG + Intronic
981977391 4:150747271-150747293 TACTTCTGTGGAGGGAAAGCAGG - Intronic
982161816 4:152578072-152578094 TTCCTATGTAGAGAGAGAGAGGG - Intergenic
984103151 4:175511768-175511790 TGACTCTGTAGAGGGAATCCAGG - Intergenic
985096570 4:186418070-186418092 TGGCTCTGCAGAAGGAAAGCAGG - Intergenic
985139724 4:186827408-186827430 CGTCTCTGCAGAAGGAGAGCAGG + Intergenic
985693454 5:1326303-1326325 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693458 5:1326332-1326354 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693464 5:1326390-1326412 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693476 5:1326482-1326504 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693488 5:1326567-1326589 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693491 5:1326596-1326618 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693494 5:1326625-1326647 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693519 5:1326741-1326763 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693525 5:1326770-1326792 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693562 5:1327002-1327024 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693569 5:1327031-1327053 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693585 5:1327118-1327140 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693593 5:1327176-1327198 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693597 5:1327205-1327227 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693606 5:1327263-1327285 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693609 5:1327292-1327314 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693613 5:1327321-1327343 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693632 5:1327437-1327459 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693638 5:1327466-1327488 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693643 5:1327495-1327517 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693649 5:1327524-1327546 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693658 5:1327582-1327604 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693661 5:1327611-1327633 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693666 5:1327640-1327662 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693669 5:1327669-1327691 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693674 5:1327698-1327720 TGTCCCTGTAGAGGAGGAGCAGG - Intronic
985693679 5:1327727-1327749 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693686 5:1327756-1327778 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693691 5:1327785-1327807 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693695 5:1327814-1327836 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693699 5:1327843-1327865 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693704 5:1327872-1327894 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693708 5:1327901-1327923 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693716 5:1327959-1327981 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693725 5:1328017-1328039 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693729 5:1328046-1328068 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693733 5:1328075-1328097 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693737 5:1328104-1328126 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693741 5:1328133-1328155 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693745 5:1328162-1328184 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693749 5:1328191-1328213 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693774 5:1328367-1328389 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693777 5:1328396-1328418 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693781 5:1328425-1328447 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693788 5:1328483-1328505 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693801 5:1328599-1328621 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693813 5:1328715-1328737 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693818 5:1328744-1328766 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693827 5:1328831-1328853 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693830 5:1328860-1328882 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693834 5:1328889-1328911 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985693839 5:1328918-1328940 TGTCCCTGTAGAGGAGGAGCTGG - Intronic
985693843 5:1328947-1328969 TGTGTCTGTAGAGGAGGAGCTGG - Intronic
985717356 5:1470165-1470187 TGCCTCTGTACAGGCAAAGCCGG + Intronic
986659386 5:10045459-10045481 GGCCTCTGGAAAAGGAGAGCAGG - Intergenic
986740674 5:10702532-10702554 TCCCTCTTTAGAGGGAGCTCAGG + Intronic
988962522 5:36384245-36384267 TGCCTGTGTAGACAGACAGCTGG - Intergenic
989108978 5:37889079-37889101 TGCCTCTGGAGATGGAGGGAGGG + Intergenic
989698593 5:44234436-44234458 TGCCTTTGTAGAAGTAGAGGAGG + Intergenic
990894076 5:60678241-60678263 TGCGACTGTAAAGGGAGAGCAGG - Intronic
991945019 5:71891263-71891285 TGGCTGTGAAGAGGGAGAGGTGG + Intergenic
992068160 5:73126065-73126087 GGCCTCTTTCCAGGGAGAGCAGG + Intronic
994159062 5:96535465-96535487 TGCCTCTGGGGAGGAAGAACAGG + Intronic
995600582 5:113791102-113791124 TGCCACTGTGGAGACAGAGCAGG - Intergenic
997884140 5:137615529-137615551 TGCCTCTGGGGAGGGGGGGCGGG - Intergenic
998770319 5:145536551-145536573 TTCCTATGTGGAGGGAAAGCTGG + Intronic
1000055522 5:157602729-157602751 GGCATCTGTAGAGGAAGAGGGGG + Intergenic
1003047744 6:2749800-2749822 TCCCTCTGCAGAGGGAGGCCAGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006193334 6:32222668-32222690 TGTCAATGGAGAGGGAGAGCTGG + Exonic
1006378514 6:33684742-33684764 GGACTCGGTTGAGGGAGAGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007574384 6:42915819-42915841 TGTCTCTTCAGAGGGAGTGCAGG + Intergenic
1007661720 6:43490784-43490806 TGCCTCAGTAGAGTGGGGGCAGG + Intronic
1011402868 6:86982687-86982709 TTCCTCTGGAGAGGGAGCTCAGG - Intronic
1017633977 6:156425506-156425528 TGCTTCTGTTGAGAGAGAGGTGG + Intergenic
1018177964 6:161195281-161195303 TGCCACTGGAAAGGGAAAGCTGG - Intronic
1019353740 7:568339-568361 TGACTCTGGGGAGGGACAGCAGG + Intronic
1020706717 7:11552964-11552986 TCCCTCTCTAGAGAGAGAGAAGG - Intronic
1023907078 7:44530784-44530806 TGACTTTATGGAGGGAGAGCAGG - Intronic
1025220447 7:57103269-57103291 TCCCTCTGTGGTGGGAGAACTGG + Intergenic
1025631264 7:63275090-63275112 TCCCTCTGTGGTGGGAGAACTGG + Intergenic
1026641550 7:72130628-72130650 TGCCTCTGCAGAGGGAAACCAGG + Intronic
1032778965 7:135146805-135146827 TGCCTCTGAAGAGGAAGAAAGGG + Intronic
1033014278 7:137656000-137656022 TGCCCCAGCAGAGTGAGAGCCGG + Intronic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034090477 7:148359424-148359446 TGCCTTTTTGTAGGGAGAGCTGG + Intronic
1034272678 7:149811056-149811078 TGCCTCTGAGGAGGGACAGCAGG - Intergenic
1034773356 7:153801448-153801470 TACAGCGGTAGAGGGAGAGCGGG + Intergenic
1035274919 7:157742206-157742228 TGCATATGTAGATGGAGAACAGG + Intronic
1036723452 8:11200118-11200140 GGCCACTGCAGAGGGAGAACGGG + Intronic
1037822461 8:22141595-22141617 TGCCTCCGCCGAGGGACAGCCGG - Exonic
1037857175 8:22380230-22380252 TGCCTCTGTACAGAGAGCTCTGG + Intronic
1037889702 8:22617409-22617431 TGCCTCTGTAGAAGGAGGATGGG + Exonic
1039333647 8:36566504-36566526 TCCCTCTGTAAAGGGTGAGGAGG + Intergenic
1039468813 8:37801343-37801365 TGCTTCTGAACAGAGAGAGCAGG + Intronic
1039918875 8:41879172-41879194 CGGCTCTCTAGAGGCAGAGCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1045325325 8:101113379-101113401 TGCCTCTTAAGTGGCAGAGCTGG + Intergenic
1045395659 8:101758299-101758321 AGCCTATGGAGGGGGAGAGCTGG - Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047366770 8:124218382-124218404 TGCTTATGTAGAGGGAGACAGGG - Intergenic
1047377973 8:124321866-124321888 TGTCTCTGGAGAGGGAGCCCTGG - Intronic
1047463633 8:125091854-125091876 TGCCGCTGAAAAGTGAGAGCGGG - Exonic
1048997214 8:139801450-139801472 TGCCTATGGAGAGGGACACCTGG + Intronic
1049310591 8:141931792-141931814 GGACTCTGTGGATGGAGAGCCGG - Intergenic
1050250909 9:3743846-3743868 ATACTCTCTAGAGGGAGAGCTGG + Intergenic
1053241756 9:36501648-36501670 TGCCTCTCAAGAGGGAGATTGGG + Intergenic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1056492304 9:87119831-87119853 TTCCTCTGTAGAAGGAGGGGAGG + Intergenic
1057302781 9:93896296-93896318 TGCCTCCTGAGAGGGAGTGCTGG + Intergenic
1058562025 9:106240388-106240410 TGCCTCTGTAGGCAGAGAGTGGG + Intergenic
1061507498 9:131039664-131039686 TGACTGTGGAGAGGGAGAGCAGG + Intronic
1061927599 9:133813588-133813610 TGCCTCTCTAGAGGGGAAGCCGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186644231 X:11489509-11489531 TGCCACTGTAGTGCAAGAGCAGG + Intronic
1186967691 X:14805613-14805635 TGCCTGTGCTGAGGCAGAGCTGG - Intergenic
1187235682 X:17464879-17464901 TGCATCTGTAAAGGGAGAAGAGG + Intronic
1190307732 X:49095107-49095129 TCCCTTTGCAGAGGGAAAGCTGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193809109 X:86030676-86030698 TCCCTCTGTAGAGGGAGTCATGG + Intronic
1195617008 X:106920495-106920517 TGCCCCTGGAGAGGGAGAAAGGG - Intronic
1196783234 X:119400775-119400797 TCCCTCTGCAGAGGAAGAGAAGG - Intronic
1199711209 X:150470810-150470832 TGCGGCTGTTGAGTGAGAGCAGG - Exonic
1200082762 X:153587172-153587194 TGCTTATGTGGAGGGAGAGATGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic