ID: 1179779514

View in Genome Browser
Species Human (GRCh38)
Location 21:43690419-43690441
Sequence CCTGGACGGCAGGGCCTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 385}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179779514_1179779530 30 Left 1179779514 21:43690419-43690441 CCCTCCAGGCCCTGCCGTCCAGG 0: 1
1: 0
2: 3
3: 39
4: 385
Right 1179779530 21:43690472-43690494 TTTCACCACAAGGGCACAGATGG 0: 1
1: 0
2: 3
3: 18
4: 216
1179779514_1179779529 21 Left 1179779514 21:43690419-43690441 CCCTCCAGGCCCTGCCGTCCAGG 0: 1
1: 0
2: 3
3: 39
4: 385
Right 1179779529 21:43690463-43690485 CACAGCACATTTCACCACAAGGG 0: 1
1: 0
2: 0
3: 19
4: 167
1179779514_1179779528 20 Left 1179779514 21:43690419-43690441 CCCTCCAGGCCCTGCCGTCCAGG 0: 1
1: 0
2: 3
3: 39
4: 385
Right 1179779528 21:43690462-43690484 GCACAGCACATTTCACCACAAGG 0: 1
1: 0
2: 0
3: 8
4: 141
1179779514_1179779522 -2 Left 1179779514 21:43690419-43690441 CCCTCCAGGCCCTGCCGTCCAGG 0: 1
1: 0
2: 3
3: 39
4: 385
Right 1179779522 21:43690440-43690462 GGTACGCACCCTCCCCAGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179779514 Original CRISPR CCTGGACGGCAGGGCCTGGA GGG (reversed) Exonic
900180064 1:1307451-1307473 GCTGGACTGCAGGGCCCGGGAGG + Intronic
900187078 1:1337615-1337637 CCTGGGCGGCTGTGCCTGGTAGG - Intronic
900357999 1:2273945-2273967 CCTGACCGGCAGCGCCAGGATGG + Intronic
900359102 1:2279384-2279406 CTTGGAGAGCAGGGCCAGGAAGG - Intronic
900407879 1:2500388-2500410 GATAGACGGCAGGGGCTGGATGG - Intronic
900496804 1:2979394-2979416 CCTGGACTGCAGAGCCCTGATGG - Intergenic
900560659 1:3304292-3304314 CCAGGACTGCAGGGCTTGGCTGG - Intronic
900643532 1:3698491-3698513 CCTGGAAGGGAGGGGCTGGTGGG + Intronic
900650369 1:3727370-3727392 CCTGGCCTGCAGGGCCTGCCTGG + Intronic
900719338 1:4165178-4165200 CCATGAGGGCAGGGCCTGGGTGG - Intergenic
901207259 1:7504209-7504231 CCTGGGCAGCAGAGCCTGGCAGG - Intronic
901530521 1:9849734-9849756 CCTGGCCGGTGGGGCCTGGACGG + Exonic
901628141 1:10635087-10635109 CCTGGTCTTCTGGGCCTGGATGG - Intergenic
901780729 1:11593030-11593052 CCAGGATGGCACAGCCTGGAAGG - Intergenic
902180173 1:14682135-14682157 GGTGGATGCCAGGGCCTGGAAGG - Intronic
902336538 1:15757945-15757967 TCTGGAAGGCAGGGCCCGGCTGG - Intronic
902467226 1:16625872-16625894 GTGGCACGGCAGGGCCTGGAGGG - Intergenic
903260292 1:22128243-22128265 CCTGGACGGCCGGGGCTGCTGGG - Intronic
903273393 1:22206066-22206088 CCTTGAGGGCAGGGCCTGTCTGG + Intergenic
903556255 1:24195823-24195845 CCTCCACGCCAGGGCCTGGAGGG - Intergenic
904044892 1:27603186-27603208 CCTGGCAGGCAGCGCCGGGAAGG - Intronic
904186530 1:28709229-28709251 CCTGGGAGGCAGGGCTTGCAGGG + Intronic
904624036 1:31792237-31792259 CCTGGTGGGCAGGGGCTGGAAGG + Exonic
905028528 1:34866688-34866710 CATCGACGGCAGAGCCTTGAGGG - Intronic
905990700 1:42335022-42335044 CCAGGGCGGCCGGGCCTGGGCGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907469779 1:54665812-54665834 CCTGCATGTCTGGGCCTGGATGG - Intronic
907909659 1:58815086-58815108 CCAGGACGGCGGGGTCTGGGAGG + Intergenic
908509374 1:64839391-64839413 CCTGGATGGAGGGGCCTGGGTGG + Intronic
909631630 1:77774567-77774589 CAGGGACAGCATGGCCTGGATGG + Intergenic
911093883 1:94040028-94040050 CCTGGATGGTAAGGACTGGACGG - Exonic
914848731 1:151298003-151298025 CTTAGAAGGCAGGGCCTAGATGG + Intronic
915195467 1:154185748-154185770 CCTGCATGGCAGTGCCTGTAGGG - Intronic
915580185 1:156808790-156808812 CCAGGACAGCAGGGCCGTGAAGG + Intronic
915913325 1:159927658-159927680 CCTGGGAGGCAGGGCCTGACTGG + Intronic
915982202 1:160427241-160427263 CCTGGAAAACAGGGCCTGGATGG + Exonic
917536378 1:175877373-175877395 GCTGGAGGTCAGGGCCTGGTGGG + Intergenic
918526080 1:185466524-185466546 CCTGGAAGGCAAGGCCAGAATGG + Intergenic
920676388 1:208041298-208041320 TCTGGGCAGCAGGGGCTGGAGGG - Intronic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
922234758 1:223713953-223713975 CCATGACGGCAGGGCCTAGTGGG - Intronic
922252709 1:223864427-223864449 CAGGGACAGCAGAGCCTGGATGG + Intergenic
922342018 1:224665136-224665158 CTTGGACAGCATGGTCTGGATGG + Intronic
922809417 1:228407370-228407392 CCTGGAGAGCTGGTCCTGGAGGG - Intergenic
923297002 1:232603720-232603742 AGTGGATGGCAGGGCCTGGAAGG - Intergenic
923573801 1:235140390-235140412 CGGGGCCGGCAGGGCCTGCAGGG - Intronic
923878242 1:238074694-238074716 CCTGTTAGGGAGGGCCTGGAAGG - Intergenic
924591878 1:245411626-245411648 CCTGGAAGGAAGGGTCTGGTGGG + Intronic
1062841657 10:678046-678068 CCTGGAGGGCAGTGCCTTGGTGG - Intronic
1065408387 10:25392893-25392915 CCAAGACAGCAGGGCCTGTACGG - Intronic
1065916598 10:30358542-30358564 CCTGGAAGAGAGGGGCTGGAAGG - Intronic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1066310673 10:34192662-34192684 CCTGGACGTCAGAGTGTGGAGGG + Intronic
1067059334 10:43069885-43069907 CCTGGAAGCCAGGGCCCAGAGGG + Intergenic
1067083081 10:43222557-43222579 CCTGGAGTGCAGTGCCTGGGAGG + Intronic
1071604189 10:86973240-86973262 CCTGGAGGGCAGGGCCAGGTGGG + Intronic
1074436871 10:113441847-113441869 CTTGGAAGGCAGGGCCATGAGGG + Intergenic
1074703999 10:116115491-116115513 CCTGGAGGGCAGGGCAGGGCTGG - Intronic
1074801646 10:117005824-117005846 CGTGGATGGTGGGGCCTGGAGGG + Intronic
1075512196 10:123081524-123081546 CCTGGACAGCAGAACCTGGCTGG - Intergenic
1076150999 10:128161903-128161925 CATAGACTGCTGGGCCTGGAAGG - Intergenic
1076329586 10:129654620-129654642 CCTGGAGCACAGGGCCTGTATGG + Intronic
1076354732 10:129843315-129843337 AGTGCACGGCAGGGCCAGGACGG - Intronic
1076603349 10:131673630-131673652 GATGGACGGCCGGGCGTGGAGGG + Intergenic
1076781893 10:132729029-132729051 CCTGGACTCCAGGGCCTGTGGGG + Intronic
1077043120 11:533245-533267 CCGGGACGGCAGGGCAGTGAGGG - Intronic
1077187250 11:1240843-1240865 CCGGGAGGGCCGGGCCTGCAAGG - Exonic
1077223142 11:1426172-1426194 CGTGGCCATCAGGGCCTGGATGG + Intronic
1077292335 11:1803683-1803705 CTTGGACAGCACGGCCTGGATGG + Intergenic
1077338873 11:2017255-2017277 CCTGGAGGGACGGCCCTGGAGGG + Intergenic
1078102569 11:8338468-8338490 CCTGGCCGGCTGGGTCTGGTGGG - Intergenic
1078451561 11:11444250-11444272 GCAGGGAGGCAGGGCCTGGAGGG - Intronic
1078901963 11:15650355-15650377 CCCGGGAGGCAGCGCCTGGATGG + Intergenic
1080590904 11:33722463-33722485 CCTGGAAGGAAGGGACAGGAAGG + Exonic
1082067375 11:47911604-47911626 CCAAGAAGGCAGAGCCTGGAGGG + Intergenic
1082812864 11:57489170-57489192 CCTGGAAGGCAGGTGCTGGATGG + Intronic
1083184273 11:61008312-61008334 CCTGGTGGGCGGGGCCTGGAGGG - Intronic
1083682239 11:64357031-64357053 CCTGTACCTCAGGGCCTAGAGGG - Exonic
1083882535 11:65555595-65555617 TCTGGAAGGCAGGGCCAGGCTGG + Intronic
1083920136 11:65778067-65778089 CTTGGGCCACAGGGCCTGGAGGG - Exonic
1084570946 11:69959535-69959557 CCTGGAGGTCAGGCCCTGGCAGG + Intergenic
1084651394 11:70491409-70491431 ACCGGCAGGCAGGGCCTGGAGGG + Intronic
1084873672 11:72115045-72115067 CCTTGAGGGCAGGGACTGAATGG + Intronic
1084884085 11:72192074-72192096 CCAGGAGGGTGGGGCCTGGACGG - Intronic
1085302414 11:75466339-75466361 ACTGAATGGCAGGGACTGGAAGG + Intronic
1085457611 11:76674133-76674155 CCTAGAAGGCAGGGCCCAGAAGG - Intergenic
1086258650 11:84910962-84910984 ACTAGATGGCAGGGTCTGGAAGG + Intronic
1089273279 11:117315911-117315933 TCAGGACGCCAGGGCCTGCAGGG + Exonic
1089353250 11:117833402-117833424 CCTGGATGGCAGGGACTGGAGGG - Intronic
1090313468 11:125764071-125764093 GCTGGACAGGAGGGACTGGATGG + Intergenic
1090964814 11:131589456-131589478 CCTGGACTGCAGTTTCTGGATGG - Intronic
1202821857 11_KI270721v1_random:72437-72459 CCTGGAGGGACGGCCCTGGAGGG + Intergenic
1091774109 12:3173122-3173144 CCTGGTCGGCTGTGCCTGGTTGG + Intronic
1092242163 12:6841641-6841663 CCCGGAAGGCAGGGCATGGGGGG + Intronic
1092249414 12:6884301-6884323 CTTGGCCTGCAGGGCCTGGGTGG - Intronic
1094338906 12:29389338-29389360 CCGGGTCCGGAGGGCCTGGAGGG - Intergenic
1095584608 12:43836260-43836282 CACGGGCGGCAGGGCCGGGAGGG - Intronic
1096120900 12:49089012-49089034 CCTTGGTGGCAGGGCCTGGATGG - Intergenic
1096372896 12:51083467-51083489 CCAGGGCGGCAGGGCGGGGAGGG + Exonic
1096503885 12:52081075-52081097 TCTGGAGGGAAGGGCCTGGATGG + Intergenic
1096525815 12:52209649-52209671 CCTGGATGTCAGGGCCAGGTGGG + Intergenic
1097733202 12:63152006-63152028 CCTGGACAGCACTGCCTGGATGG - Intergenic
1102855577 12:116290255-116290277 CCTTGAGGGCAGGGTCTTGAGGG + Intergenic
1103602036 12:122060350-122060372 CCTTGATGGCCGGGCCTCGAAGG + Exonic
1103604995 12:122079493-122079515 ACTGGAGGGGAGGGCCTGGATGG - Intronic
1103611718 12:122128091-122128113 CCTGGCCCCCAGGGCATGGATGG - Intronic
1104030887 12:125065337-125065359 GCGGGAGGGCGGGGCCTGGAAGG + Intergenic
1104347559 12:128015143-128015165 TCTGGACTGCAGGGCAGGGAGGG + Intergenic
1104614965 12:130259808-130259830 TCTGGATGGCGGTGCCTGGAGGG - Intergenic
1104768578 12:131346166-131346188 CCAGGGCGGGAGGGGCTGGAGGG - Intergenic
1104842812 12:131832684-131832706 ACAGGACGGCAGGGACAGGACGG + Intronic
1105000657 12:132687855-132687877 CCTGGACGGGAGCGCCGGGCCGG + Intronic
1105383063 13:19905372-19905394 CCTGGATGGTTGTGCCTGGATGG - Intergenic
1108140511 13:47416108-47416130 CCTGGAGGACAGAGCCAGGAGGG + Intergenic
1113590333 13:111494385-111494407 AGTGGATGGCAGGGCATGGAGGG + Intergenic
1117711873 14:58538803-58538825 CCTGGACGACAGAGCCAGGCTGG - Intronic
1118753158 14:68821008-68821030 CCCAGACGGCAGTGCCAGGATGG - Intergenic
1121021596 14:90583621-90583643 GCTGCAGGGCAGGGTCTGGAAGG + Intronic
1121406974 14:93725096-93725118 CCTGGAAGGCAGGGTGAGGAGGG + Intronic
1121484797 14:94306322-94306344 GCTGGAGGGCAGGAGCTGGAGGG - Intronic
1121732301 14:96195110-96195132 CCTGCCTGGCAGGGCCTGGCTGG + Intergenic
1122205415 14:100145734-100145756 CCTGGAGGGCAGGGCTGGGTTGG - Exonic
1122521063 14:102344099-102344121 CCTCCAGGGCAGGACCTGGAAGG - Intronic
1122714226 14:103684405-103684427 ACTGGACTTCAGGGCCTGGGAGG - Intronic
1122782006 14:104147650-104147672 CCTGGACAGCAGGACCTGCGAGG + Intronic
1123001974 14:105300708-105300730 CCTGGGCGGCTGGGCCTGGGCGG - Exonic
1124237671 15:28004010-28004032 CCTGGGTGGCAGCGGCTGGACGG - Intronic
1124636259 15:31366699-31366721 CCTGAAGGGCCGGGCCTGGCTGG + Intronic
1125979787 15:43989757-43989779 CAGGGACAGCACGGCCTGGATGG + Intronic
1127104129 15:55595197-55595219 CCAGCACTGCAGGACCTGGAAGG + Intergenic
1129255403 15:74331343-74331365 CCAGGAAGGCAGGGCCTCCAGGG - Intronic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1129608659 15:77036985-77037007 CCTGCAGGGAAGGGCCTGCAGGG - Intronic
1129706184 15:77795904-77795926 TCTGGGTGGCAGGGCATGGAGGG - Intronic
1129727636 15:77909632-77909654 CCTGGAAAACAGGGGCTGGAAGG - Intergenic
1131116933 15:89801645-89801667 CCTGGATGGCAGGGACTGGAGGG - Intronic
1132571657 16:646907-646929 CATGGACGGATGGACCTGGACGG - Intronic
1132732716 16:1370643-1370665 GTTGGCCGGCAGGGCCTGGTGGG - Intronic
1132744838 16:1432272-1432294 GCTGGACGGCTGGCCCAGGATGG - Intergenic
1132854339 16:2038127-2038149 CCTGGTGGGCAGGGGCAGGATGG - Exonic
1134038582 16:11050757-11050779 GCTGGACGGCAGGTGCTGGTGGG - Intronic
1134421486 16:14095110-14095132 CCTGAAAGGCAGTGCATGGAAGG + Intronic
1134676533 16:16094587-16094609 CCTGGGCGGCAGAGCTTGCAGGG - Intronic
1135284048 16:21178229-21178251 CCTGAGCTGCAGGCCCTGGAAGG - Intronic
1136035710 16:27538308-27538330 CCTGTACCGCATGGCCTGGGAGG + Exonic
1136270210 16:29144077-29144099 TGTGGACAGCAGGGCCTGGCTGG + Intergenic
1138196011 16:55052827-55052849 GATGGGCGGCAGGGCCTGGGAGG - Intergenic
1138230321 16:55331541-55331563 CCTGGAAGGCCTGGCCTGGCCGG - Intergenic
1139207828 16:65046284-65046306 CCTGGACCACAGGGCCCGGAAGG + Intronic
1140862614 16:79031325-79031347 CCAGGACTGCAGTGCCAGGATGG - Intronic
1140901382 16:79371161-79371183 CCTGGAGGGCTGGGCCCTGATGG + Intergenic
1141132577 16:81445623-81445645 CCTGGAGCCCAGGGCCTGGGGGG + Intronic
1141694440 16:85613038-85613060 CCTGGCCGGCCGGGCCGGGGAGG + Intronic
1142073801 16:88105911-88105933 TGTGGACAGCAGGGCCTGGCTGG + Intronic
1142889093 17:2931445-2931467 CCAGGACAGCGGGGCCGGGAAGG + Intronic
1143028388 17:3953977-3953999 GCTGGACTGGAGGGGCTGGAAGG - Intronic
1143498420 17:7325294-7325316 CCTGGGCGGCAGGGGCAGCACGG + Exonic
1146836901 17:36118257-36118279 GCTGGAAGGCAGGGTCTGCAGGG + Intergenic
1146914922 17:36672285-36672307 CCTGGAGGTCAGGGCAGGGATGG - Intergenic
1147780076 17:42934832-42934854 CAGGGACCGCAGGGGCTGGAGGG - Intergenic
1148016857 17:44528071-44528093 CCGGGCCGGCAGGGCCGGCAGGG - Intergenic
1148348723 17:46923077-46923099 CCTGGCCGGCAGGGGAGGGAGGG + Intergenic
1148602030 17:48901480-48901502 CCTGCAAGTCAGGGCCTGAAGGG - Intergenic
1151187387 17:72374142-72374164 CCTGCACGGCTGGGCCTGCTGGG + Intergenic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1151494197 17:74449762-74449784 CCAAGATGGCAGGGCCAGGAAGG - Intronic
1151517790 17:74607583-74607605 CATGGAGGGCAGAGCATGGAGGG + Intergenic
1151517814 17:74607681-74607703 CATGGAGGGCAGAGCATGGAGGG + Intergenic
1151926463 17:77201210-77201232 CCTGCAAGGCAGGGTATGGAAGG - Intronic
1152175093 17:78782131-78782153 GCCGGACGGCCGGGCCCGGAGGG + Intronic
1152236050 17:79139436-79139458 TCTGGGCTCCAGGGCCTGGAAGG + Intronic
1152624180 17:81380688-81380710 CATGGAGGGCAGGGGCTGCACGG + Intergenic
1152653375 17:81507285-81507307 CCTGGATGACAGAGCCAGGATGG + Intergenic
1152733167 17:81983436-81983458 CGTGGATGGCGGGGCGTGGATGG + Intronic
1152733172 17:81983450-81983472 CGTGGATGGCGGGGCGTGGATGG + Intronic
1152755099 17:82083922-82083944 CCAGGGCGGCGGGGCCAGGAGGG + Intronic
1153551846 18:6270753-6270775 GCTGCACTGCAGGGGCTGGAGGG + Intronic
1153564962 18:6410136-6410158 ACAGGAGGGCAGGGCCTGGGTGG - Intronic
1153693046 18:7612977-7612999 GCAGGAGGGCAGGACCTGGAGGG + Intronic
1155289371 18:24325302-24325324 CCAGGCCTGCAGGGCCTGGTTGG - Intronic
1157493932 18:48142249-48142271 CCTGTCCTGCAGGGGCTGGAAGG + Intronic
1158945280 18:62442413-62442435 CAGGGACAGCAAGGCCTGGATGG - Intergenic
1159116795 18:64123753-64123775 GTTGGAAGGCAGGGCCTGGTAGG + Intergenic
1160583658 18:79901238-79901260 CCTGGGCTGCAGGGTCTGGTGGG + Intergenic
1160932463 19:1577158-1577180 ACTGGGCAGCAGGGCCAGGAGGG + Exonic
1160937693 19:1605049-1605071 CCTGGACGGAAGCGCCCAGAAGG - Intronic
1162259228 19:9518869-9518891 CAGGGACAGCAGAGCCTGGATGG - Intergenic
1163102703 19:15107678-15107700 CCTGGAAGGAAGGGGCTGGGAGG + Intronic
1163153348 19:15427601-15427623 CCTGGTCGGCTGGGCGTGGGCGG + Intronic
1163303593 19:16463223-16463245 CCTGGTGGGCAGAGCCTGGTGGG - Intronic
1164616030 19:29667227-29667249 CCAGCAGGGCAGGGCCTGGGAGG - Intronic
1164638018 19:29805647-29805669 CCTGGAGGGCAGGGCCATGTCGG + Intergenic
1165403872 19:35618428-35618450 CATGGACGGCAGGGTCTGGCTGG - Exonic
1165532930 19:36418816-36418838 ACGGCGCGGCAGGGCCTGGAGGG + Intergenic
1165797392 19:38526903-38526925 CCTGGGGTGCTGGGCCTGGAAGG + Intronic
1166354420 19:42218435-42218457 CCTGGAGGGCAGAGATTGGAAGG - Intronic
1166529491 19:43534056-43534078 CCAGGACTGCAGGGTCTGGTGGG + Intronic
1166570296 19:43791632-43791654 CCTGGAAGGCAGAGCTTGCAGGG - Intergenic
1166752384 19:45170475-45170497 CCAGGACGGCAGCCCCCGGAGGG + Intronic
1166838439 19:45681814-45681836 GCCGGAGGGCAGGGCCCGGAAGG - Exonic
1166862834 19:45819634-45819656 CCTGGACTGTAAGCCCTGGAAGG + Intronic
1166891227 19:45995104-45995126 CGTGGTGGGGAGGGCCTGGAAGG - Intergenic
1168002936 19:53463526-53463548 TCTGAAGGGCGGGGCCTGGAGGG + Intergenic
1168135342 19:54347343-54347365 ACTAGACAGCAGGGCCAGGAGGG - Intergenic
1168412150 19:56146882-56146904 CCCGGACCGCAGCGCCTGCAGGG - Exonic
925823577 2:7824353-7824375 CCTGGACACCAGGATCTGGAAGG + Intergenic
927194294 2:20537211-20537233 CCTGGGGTGCAGGGTCTGGATGG - Intergenic
927847126 2:26477382-26477404 ACTGGACGGCGGGGGCTGGAGGG - Intronic
927893076 2:26764491-26764513 CCAGGAGGGCAGGGCCAAGAAGG - Intronic
928836988 2:35559160-35559182 CATGGATGGAAGTGCCTGGATGG + Intergenic
930189237 2:48440918-48440940 CCTGGGCGGCCTGGCCTGTACGG + Exonic
930623980 2:53675894-53675916 CCTGCATTGCAGGGCATGGAGGG + Intronic
931587286 2:63841734-63841756 CCTGGACGGCGGCGCGGGGAGGG + Exonic
931649361 2:64454363-64454385 CCTGGCAGGCAGAGCCTGGGAGG - Exonic
932047652 2:68365618-68365640 TCCAGATGGCAGGGCCTGGAAGG + Intronic
932438433 2:71716869-71716891 CCTGGAGGGGAGGGGCTTGAGGG - Intergenic
932485395 2:72081465-72081487 CCAGGAGGGAAGTGCCTGGATGG + Intergenic
932573637 2:72951074-72951096 CCTGGAGGGCAGGGGCTGCAGGG + Intronic
932653716 2:73588264-73588286 CCTGGACTGCAGAGACTGCAGGG - Intronic
932806937 2:74792417-74792439 CCAGGAAGGCAGGGCCTAGTAGG + Intergenic
934547968 2:95234472-95234494 TCTGGACGGACGGGCCTGGCAGG + Intronic
935349776 2:102142999-102143021 CCTGGACGGACGGCCGTGGAGGG - Exonic
935351375 2:102154320-102154342 AATGGACAGCAAGGCCTGGAAGG - Intronic
936095586 2:109528433-109528455 CCAGGAGGGCAGGGCATGGAAGG - Intergenic
938207569 2:129437339-129437361 CATTGAAGGAAGGGCCTGGAGGG + Intergenic
938279413 2:130053563-130053585 CCTAGTCAGCAGGGCCTGGTGGG - Intergenic
938330363 2:130444277-130444299 CCTAGTCAGCAGGGCCTGGTGGG - Intergenic
938333204 2:130463518-130463540 CAGGGACAGCATGGCCTGGATGG + Exonic
938356608 2:130657153-130657175 CAGGGACAGCATGGCCTGGATGG - Exonic
938359583 2:130677226-130677248 CCTAGTCAGCAGGGCCTGGTGGG + Intergenic
938433040 2:131263959-131263981 CAGGGACGGCACGGCCTGGATGG - Exonic
938435982 2:131283872-131283894 CCTAGTCAGCAGGGCCTGGTGGG + Intronic
941918001 2:170824434-170824456 CCTGGAGGGATGGACCTGGAGGG + Intronic
942226156 2:173818061-173818083 CTTGGAAGGCATGGCATGGAAGG - Intergenic
942279146 2:174343405-174343427 CCTCGACAGCCGGCCCTGGAGGG - Intergenic
945197838 2:207253846-207253868 TCTGTAAGGCAGGGACTGGAGGG + Intergenic
947166072 2:227263809-227263831 CCTGGATGGCCAGGCCTGAAAGG + Exonic
948454176 2:238097114-238097136 GAGGGAGGGCAGGGCCTGGAGGG + Intronic
948824571 2:240568177-240568199 CCTGGCCGGCAGTGTCTGGGAGG + Intronic
948839237 2:240641070-240641092 CCTGGATGGCCGGGGATGGAAGG - Intergenic
1169091277 20:2862716-2862738 CCTGGATGGCCGGGCCGGGGAGG + Intronic
1172581331 20:36050881-36050903 CCGGGGCCGGAGGGCCTGGAGGG + Intergenic
1172878658 20:38182470-38182492 CCTCAACTGCAGGGGCTGGAAGG + Intergenic
1174136245 20:48382085-48382107 CATGGACAGCAAGGCCTGGGTGG - Intergenic
1174187663 20:48718168-48718190 CCTGAATGTCAGAGCCTGGAGGG - Intronic
1174357488 20:50008430-50008452 ACAGGACAGCAGGGCCTGGCCGG + Intergenic
1174708851 20:52684425-52684447 CATGCACAGCCGGGCCTGGAAGG - Intergenic
1175241039 20:57549125-57549147 CCGGGAAGCCAGGGCCTGCACGG - Intergenic
1175396692 20:58669313-58669335 CCGGCTCGGCAGGGCCTGCACGG - Exonic
1175823695 20:61925131-61925153 CCTGGACGGGAGGGCGAGGATGG + Intronic
1175943816 20:62549772-62549794 CCTTGGTGGCAGGGCCTGGCTGG + Intergenic
1176024211 20:62977587-62977609 CCTGGAAAGCAGGGCCCGGAGGG + Intergenic
1176116505 20:63433957-63433979 CCAGGAGGGCCGGGCGTGGAGGG + Intronic
1176132684 20:63502936-63502958 CCCGGGCAGCAGGGCCTGGAGGG - Intergenic
1176167567 20:63682048-63682070 CCTGCAGCCCAGGGCCTGGAGGG + Intronic
1176520763 21:7822367-7822389 GCTGGATGGCAGGGCAGGGATGG - Intronic
1178298333 21:31429571-31429593 CCTGGACGGCAGGGAGTGAGTGG + Intronic
1178654787 21:34452379-34452401 GCTGGATGGCAGGGCAGGGATGG - Intergenic
1179115696 21:38490023-38490045 ACTGCACAGCAGGTCCTGGAAGG - Intronic
1179615302 21:42579637-42579659 CCTGGCCCGCAAGGCCTGGGCGG - Intronic
1179779514 21:43690419-43690441 CCTGGACGGCAGGGCCTGGAGGG - Exonic
1179879244 21:44286597-44286619 CCAGGACAGGAGGGCGTGGAAGG - Exonic
1180083480 21:45497259-45497281 CCTGGACGGCTGTGCTGGGAGGG - Intronic
1180539094 22:16424430-16424452 ACTGGACTGCAGGTCCTGGTTGG - Intergenic
1181088941 22:20458884-20458906 CCTGGACTGCAGGCTCTGTAAGG + Intronic
1181509945 22:23384680-23384702 CTTGGGCGGCAGGGCCTCGTGGG - Intergenic
1181599803 22:23942811-23942833 CCTGTCCCGCAGGGCCTGGCTGG + Intergenic
1181608704 22:23998507-23998529 CCTGTCCCGCAGGGCCTGGCTGG - Intergenic
1181951876 22:26559887-26559909 CCTGGACAGCAGGGCCTTCTAGG + Intronic
1182122594 22:27797441-27797463 CCTGGACGGCGGGGCCAAGTCGG - Exonic
1182226166 22:28800408-28800430 CATGAGCGGCAGGGCCTGGCCGG + Exonic
1182353508 22:29711632-29711654 CCTGGTAGGCAGGGCCAGGTGGG - Intergenic
1183290338 22:36998227-36998249 ACTGGAAGGCAGGATCTGGAAGG + Intronic
1183323677 22:37180195-37180217 GCTGGACGGCAGGGCGTGGCGGG + Exonic
1183410668 22:37653498-37653520 CCTGGTAGGTAGGGCCAGGATGG - Intronic
1183829751 22:40411512-40411534 CCTGGACAGCATGGACTGGCTGG - Exonic
1183910395 22:41074815-41074837 CAGGGACAGCATGGCCTGGATGG + Intergenic
1183951832 22:41356815-41356837 CTGGGAGGGCAGGGCCTGGCGGG + Intronic
1184037732 22:41926503-41926525 CCCTGTGGGCAGGGCCTGGAGGG - Intronic
1184198684 22:42949982-42950004 CCTGGACCGCAGGGCCTGCATGG - Intronic
1184246370 22:43237807-43237829 CCTAGAGAGCAGGGCGTGGAGGG - Intronic
1184309243 22:43630626-43630648 GCTGGTCGGCAGGGCCTCCACGG - Intronic
1184379550 22:44136540-44136562 TCGGGGCAGCAGGGCCTGGAAGG - Intronic
1184455144 22:44605906-44605928 CCTGGAGGGGAGGCTCTGGACGG + Intergenic
1184655008 22:45936682-45936704 CCTGGACATCAGGGTCTGGCTGG - Intronic
1185129776 22:49032352-49032374 CCTGGAGAGCCGGGCATGGAGGG + Intergenic
1185231351 22:49685989-49686011 CCTGGACGGGAGGCCCTGCGGGG - Intergenic
950425468 3:12922773-12922795 TCTGTGGGGCAGGGCCTGGAGGG + Intronic
950610447 3:14123749-14123771 ACTGGATACCAGGGCCTGGAGGG + Intronic
954131340 3:48562730-48562752 CCTGGATGGGAAGACCTGGAGGG - Exonic
954256744 3:49412452-49412474 CGTGGCCGGCAGAGCCTGCAAGG - Exonic
954458276 3:50611688-50611710 GCTGGACGGCGGCGGCTGGAGGG + Exonic
954682574 3:52353663-52353685 GCTGTCCGGCAGGGCCTGGCTGG - Intronic
955728776 3:61961169-61961191 CCTGGAAGGAGGGGCCAGGAAGG + Intronic
956758121 3:72410280-72410302 CCTGGAGGGCAGGGACTGTTAGG - Intronic
961213700 3:125143857-125143879 CCTAGACCGCAGGGCATGGCAGG - Intronic
961672816 3:128547384-128547406 CCTGTACTGCAGAGGCTGGAAGG - Intergenic
962282377 3:134061567-134061589 CCAGGGAGGCAGGGGCTGGATGG + Intergenic
962342513 3:134597212-134597234 CCTGGATGGCAGGGGCAAGAGGG + Intergenic
966079147 3:175978188-175978210 CAGGGACAGCACGGCCTGGATGG + Intergenic
968130418 3:196189830-196189852 GCTGGACGGGTGAGCCTGGAAGG + Intergenic
968514301 4:1009875-1009897 CCTGGCGGGCGGGGCCGGGACGG - Intergenic
969222940 4:5773199-5773221 CCTGGACAGCAGGAGATGGAGGG - Intronic
969701092 4:8768182-8768204 CCTGGAGGTCAGCTCCTGGAGGG + Intergenic
969728332 4:8938982-8939004 GATGGAAGGCAGGGCCCGGACGG + Intergenic
971137529 4:23886167-23886189 CTTGGAAGGCAGGGCCATGAGGG - Intronic
971232142 4:24808514-24808536 CCTGGATGGCCAGGCCTGGCGGG + Exonic
972312001 4:37890868-37890890 CCTGGGCAGCACGGCCCGGACGG - Intergenic
973716483 4:53682020-53682042 CCTGGTTGCCAGGGCCAGGAAGG + Intronic
978600132 4:110418903-110418925 TCTGAAGGGCAGGGCCTGGAGGG + Intronic
980134333 4:128845580-128845602 CCTGGGAGGTAGGGCCTGGGTGG + Intronic
981221996 4:142248024-142248046 CCTGGAGGGCAGGGGCAGGAGGG - Intronic
981688437 4:147480896-147480918 CCTGCCCTTCAGGGCCTGGAAGG + Intronic
982376123 4:154692736-154692758 CCTGGAGAGCAAGGCCTGGTTGG - Intronic
982827107 4:160015396-160015418 CAGGGACAGAAGGGCCTGGAAGG + Intergenic
984626863 4:182017193-182017215 CCAGGAGGGCAGGGTGTGGATGG - Intergenic
984702366 4:182826451-182826473 GCTGGAGTGCCGGGCCTGGATGG - Intergenic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
985541804 5:490859-490881 GCTGGACGGCAGGGACTACAGGG + Intronic
985574189 5:665933-665955 GATGGAAGGCGGGGCCTGGAGGG - Intronic
985716664 5:1466933-1466955 CCTGGACAGCGGGGCCTGGTGGG - Intronic
986125672 5:4880643-4880665 CCGGAAGGGCATGGCCTGGAGGG - Intergenic
987137508 5:14913639-14913661 CCTGGAAGGCTGGAACTGGAAGG + Intergenic
987286755 5:16465240-16465262 CATGGACGGCTGGGCCTTGATGG + Exonic
988984308 5:36601965-36601987 CTTTGAGGGCAGGGCCTGTATGG - Intergenic
989123220 5:38025688-38025710 CCTTCACGCCAGGGCCTGGGAGG - Intergenic
989547687 5:42693659-42693681 TAGGGAAGGCAGGGCCTGGAAGG - Intronic
992801552 5:80300379-80300401 CAGGGACAGCACGGCCTGGATGG + Intergenic
992807497 5:80351876-80351898 GCTGGAGCGCAGCGCCTGGATGG + Intergenic
994098828 5:95872770-95872792 TGTGGACAGCAGGTCCTGGATGG - Intergenic
995870348 5:116737804-116737826 CCTGAAGGGGAGGGCCTGGGTGG + Intergenic
997431300 5:133842973-133842995 CTTGGAAGTCAGGGCCTGCAGGG - Intergenic
998894156 5:146780410-146780432 CTCGTACCGCAGGGCCTGGATGG - Intronic
999314511 5:150575269-150575291 CCTCCATGGCAGGGCCAGGATGG - Intergenic
1000286740 5:159833420-159833442 GCTGGAAGGCAGGGAATGGAGGG - Intergenic
1001286984 5:170431005-170431027 GCAGGAGGGGAGGGCCTGGAGGG - Intronic
1002106311 5:176880982-176881004 CCTGGGTGGCTGGGCCTGGCTGG + Exonic
1002197289 5:177508414-177508436 ACAGGTCGGCAGGGCCTGGCCGG - Exonic
1003991441 6:11490457-11490479 ACTGGAAGGTAGGTCCTGGAGGG + Intergenic
1006449546 6:34098361-34098383 CCTGGAGGGCATGCCCAGGAGGG - Intronic
1006582648 6:35085827-35085849 CCTGGACTTCTGGGCCTGCAGGG - Exonic
1007495983 6:42260667-42260689 CCTGGCCTGCAGGGCCTGAGAGG - Intronic
1007809672 6:44476960-44476982 CCAGGCTGACAGGGCCTGGAAGG + Intergenic
1008072102 6:47108109-47108131 CCTGGAAGGAAAGGCATGGAGGG - Intergenic
1011527043 6:88276582-88276604 CAGGGACAGCACGGCCTGGATGG + Intergenic
1011693164 6:89888034-89888056 CCTGGAAGGCGGGGCCTGTAGGG + Intergenic
1013542323 6:111122796-111122818 CCTGAAGGGCAGGGTCTGGGAGG - Intronic
1017962509 6:159233915-159233937 CCGGGTCGGCTGGGCCTGGCGGG - Exonic
1019506183 7:1392686-1392708 CCTGGGAGCCAGGGCCTGGAGGG + Intergenic
1019526528 7:1482969-1482991 CCCCGAGGGCAGGGGCTGGATGG - Intronic
1019697062 7:2451850-2451872 CCTGGGCGGCTGGACCAGGAGGG + Intergenic
1020124571 7:5526383-5526405 CCTGGACCTCAGGGCCTGCCTGG - Intergenic
1022096747 7:27145941-27145963 CCGGTAAGCCAGGGCCTGGAGGG + Intronic
1023823767 7:43995087-43995109 CCTGGAGGGCCGGGCCAGGGTGG + Intergenic
1023856774 7:44188929-44188951 GCTGGACGACAGAGCCAGGATGG - Intronic
1023865190 7:44235093-44235115 CCAGGAAGGCAGGGCCCGGGAGG - Intronic
1023966488 7:44965548-44965570 CCGGGCCTGCAGTGCCTGGATGG - Intronic
1024318931 7:48046097-48046119 CCTGGGACGCAGGGCCTGGAGGG + Intronic
1024963735 7:55004283-55004305 CCTGAGCTGCAGGGCCGGGAAGG - Intergenic
1025944502 7:66095470-66095492 ACTGGGATGCAGGGCCTGGAGGG + Intronic
1027201897 7:76069251-76069273 CCTGGAAGGCAGGAGCTAGAGGG - Intergenic
1028237038 7:88374522-88374544 CCTGTACTGCAGAGGCTGGAAGG + Intergenic
1028868035 7:95736255-95736277 TCTGGGAGCCAGGGCCTGGAGGG + Intergenic
1029125842 7:98294867-98294889 CCTGGGTGGCAGGTGCTGGAAGG - Intronic
1029451963 7:100646493-100646515 CCTGGACAGCTGAGCCAGGACGG + Intronic
1029752034 7:102548500-102548522 CCTGGAGGGCCGGGCCAGGGTGG + Intronic
1029769986 7:102647594-102647616 CCTGGAGGGCCGGGCCAGGGTGG + Intronic
1030138935 7:106285343-106285365 GCGGGAGGGCGGGGCCTGGAGGG + Intronic
1032311761 7:130794078-130794100 GCAGGATGGCAGGGTCTGGATGG - Intergenic
1032316823 7:130845611-130845633 CCTGGAGGGCAGGGCATGCGGGG - Intergenic
1033597688 7:142868555-142868577 CCCGGCCCACAGGGCCTGGATGG - Exonic
1034293202 7:149948534-149948556 CCTGGACTGGAGGGCTGGGATGG - Intergenic
1034812872 7:154148345-154148367 CCTGGACTGGAGGGCTGGGATGG + Intronic
1035301498 7:157900551-157900573 CCTGGACCTCAGGGCCAGCAAGG - Intronic
1035375261 7:158403290-158403312 TCAGTACGGCAGGGCCTGCATGG - Intronic
1036612670 8:10363492-10363514 CAGGCACGGTAGGGCCTGGAGGG - Intronic
1036690353 8:10941130-10941152 CCTGTTGGACAGGGCCTGGAGGG - Intronic
1037858007 8:22385345-22385367 CCAGGAGGGCAGAGACTGGAGGG - Intronic
1040104764 8:43535346-43535368 CCTAGTCAGCAGGGCCTGGTGGG + Intergenic
1040110508 8:43565073-43565095 CCTGGAGGCCAGTGCCTGTATGG - Intergenic
1041313905 8:56542370-56542392 CCAGGACACCAGGGACTGGATGG - Intergenic
1042449314 8:68925929-68925951 CCTGAAAAGGAGGGCCTGGAGGG - Intergenic
1043728708 8:83647335-83647357 TCTGGAAAGCAGGGACTGGAGGG - Intergenic
1047206995 8:122810583-122810605 TGTGGACGGCAGGTCCTGGAAGG + Intronic
1047533517 8:125698522-125698544 CCAGGACGGCAGGGCATGGTGGG + Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1048565931 8:135597208-135597230 AATGGATGGCAGGGACTGGAGGG + Intronic
1049237322 8:141518770-141518792 CCTGGGCGGCTGGGCCCGGCGGG + Intergenic
1049428687 8:142549366-142549388 GCGGGAGTGCAGGGCCTGGAGGG + Intergenic
1049428697 8:142549386-142549408 GGGGGAGGGCAGGGCCTGGAGGG + Intergenic
1049428715 8:142549442-142549464 TCTGGAGTGCAGGGCCTGGAGGG + Intergenic
1049477559 8:142803821-142803843 CCTGTAAGGCAGGTCCTGTAGGG + Intergenic
1049540906 8:143208344-143208366 CCTGGAAGGCAGGAACTTGATGG - Intergenic
1049591590 8:143465291-143465313 CCAGGAAGGCAGGGGGTGGACGG - Intronic
1049614220 8:143569182-143569204 CCTGGGAGGCGGGGCCTGGGAGG + Intronic
1049654369 8:143791308-143791330 CCTGGAGGGCAGGGACAGGTGGG + Exonic
1049725463 8:144143662-144143684 CATGGAGGGCAGTGCATGGAAGG + Intergenic
1049818784 8:144621497-144621519 GCTGGGGGGCAGGGCCTGGCAGG + Intergenic
1054904099 9:70399794-70399816 TTTGGAAGGAAGGGCCTGGAAGG - Intronic
1056718532 9:89053929-89053951 GCTGGACAGCAGGGCCGGGAGGG - Intronic
1057646831 9:96884341-96884363 CCTTCATGACAGGGCCTGGAGGG - Intergenic
1059234596 9:112751015-112751037 CGTGGACGGCAGGGCCTTGGGGG - Exonic
1059429868 9:114243531-114243553 CCTGGGAGGCCCGGCCTGGATGG + Exonic
1060529457 9:124339838-124339860 CCTGGTCTGCAGGGCCAGGCTGG + Intronic
1061015051 9:127976751-127976773 CCAGGACGGCAGGTGCTGTAGGG + Intronic
1061654680 9:132079764-132079786 GCTGGAGCGCAGCGCCTGGATGG + Exonic
1061890620 9:133617273-133617295 CATGGAGGGAAGGGGCTGGAAGG - Intergenic
1061965002 9:134008450-134008472 CCTGGAGGGCAAGGCCTGGGGGG - Intergenic
1062364000 9:136200370-136200392 CCTGGGTGGCTGGGCCTGGCTGG - Intronic
1062448596 9:136606163-136606185 CCTGGACGGCAGCTCTTGGCTGG + Intergenic
1062501953 9:136855476-136855498 GCTGGGCGGCAGGGGCTGGGGGG - Exonic
1062568764 9:137174896-137174918 CCTGCAGGGCAGCGCCTGGCGGG + Exonic
1187158601 X:16744172-16744194 ACTGGAGGGCAGAGCCTGAATGG - Intronic
1189446285 X:41084909-41084931 GCTGGGCGGCAGGGACTGGCGGG - Intergenic
1189558140 X:42166206-42166228 CCTGCATGGCTGGGCATGGAGGG - Intergenic
1190316614 X:49156035-49156057 TCTGGTCGGCGGGGCCTTGAGGG - Intergenic
1191104109 X:56761694-56761716 CCTGGAAGGCAGGGTCCGGTTGG + Intergenic
1192435256 X:71139383-71139405 CCTGGGGAGAAGGGCCTGGATGG + Intronic
1192914685 X:75639422-75639444 CCTGGAGGTTAGGGCCTGGTGGG - Intergenic
1198218812 X:134581157-134581179 CCTGGATGTCAGGGCTTGGATGG + Intronic
1198312336 X:135435093-135435115 GCGGCGCGGCAGGGCCTGGAGGG + Intergenic
1199978068 X:152905877-152905899 CCTGGAGGGGAGTCCCTGGAGGG - Intergenic
1200161578 X:154012514-154012536 CCTGGGCGGCAGCACCTGGGAGG + Exonic
1200179603 X:154142377-154142399 AATGGAAGGCAGGGTCTGGAAGG - Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic