ID: 1179779788

View in Genome Browser
Species Human (GRCh38)
Location 21:43692042-43692064
Sequence CTTAACAGGTCCCAGGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179779788_1179779790 -10 Left 1179779788 21:43692042-43692064 CCAATTGCCTGGGACCTGTTAAG 0: 1
1: 0
2: 0
3: 8
4: 193
Right 1179779790 21:43692055-43692077 ACCTGTTAAGAGAAGCTACCTGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179779788 Original CRISPR CTTAACAGGTCCCAGGCAAT TGG (reversed) Intronic
901443210 1:9292296-9292318 CTGAACAGGTCCCAGCCTCTGGG - Intergenic
902718135 1:18286762-18286784 CTTACCATGTGCCAGGCACTGGG - Intronic
903709097 1:25308746-25308768 CTTTGCAGGACCCAGGCAAAGGG + Intronic
903718018 1:25383674-25383696 CTTTGCAGGACCCAGGCAAAGGG - Intronic
904734775 1:32623105-32623127 CATAAAATGTACCAGGCAATAGG + Intronic
904986972 1:34559434-34559456 CATAACAGGTTCCAGGCCTTGGG - Intergenic
906821774 1:48937553-48937575 CTTAACAGATCCCGGGCTCTGGG - Intronic
907858781 1:58329893-58329915 ATTAGCATGTCTCAGGCAATAGG - Intronic
908269719 1:62411169-62411191 GTTCACAGGTTCCAGGCATTAGG + Intergenic
908632259 1:66122261-66122283 CTTAACATGTCCCTGGCACATGG - Intronic
910142312 1:84039140-84039162 CTTAACATGTCCCAGATAATTGG - Intergenic
910749422 1:90612592-90612614 CTTCACAGTTCCCAGTCAACAGG + Intergenic
913149070 1:116022319-116022341 CTTAGAAAGTCCCAGGAAATTGG - Intronic
913599187 1:120406300-120406322 CTAACCAGGTTCCAGGCAAGAGG + Intergenic
914088190 1:144473320-144473342 CTAACCAGGTTCCAGGCAAGAGG - Intergenic
914244876 1:145878177-145878199 CATCACAGGTACCAGGCACTTGG - Intronic
914310421 1:146460890-146460912 CTAACCAGGTTCCAGGCAAGAGG + Intergenic
914334540 1:146702429-146702451 CTTATCAGGTCTCAGGGCATTGG - Intergenic
914591688 1:149112252-149112274 CTAACCAGGTTCCAGGCAAGAGG - Intergenic
914939725 1:152012254-152012276 CTTAACAGGTCCCAGAGAGAAGG + Intergenic
916439247 1:164806768-164806790 CCTACCAGGTTCCAGGCACTGGG - Intronic
924444507 1:244116730-244116752 ATTTACAGGTCCCAGGGATTAGG - Intergenic
924657346 1:245984979-245985001 CTTAACAGTTTCCAGGCCAATGG + Intronic
1066541698 10:36454276-36454298 CTTACCAGGTCACATGAAATAGG - Intergenic
1074824180 10:117202665-117202687 CTAAGCTGGTCCCAGGCAAGGGG + Intronic
1079417417 11:20252467-20252489 CATTACAGGTCCCAGGAATTAGG + Intergenic
1081878513 11:46428053-46428075 CTAAACAGGTCCCAGGCAGCAGG - Intronic
1084309210 11:68306567-68306589 ATTCACAGGTCCCAGGGATTAGG + Intergenic
1085815064 11:79728353-79728375 CCTAACAACTCCCAGGGAATGGG - Intergenic
1086191736 11:84087519-84087541 ATTCACAGGTTCCAGGCATTGGG - Intronic
1086989813 11:93290520-93290542 TTAATCAGGTCCCAGGCAACTGG - Intergenic
1087621966 11:100553283-100553305 CTTAACAGATCAAAGGCAAAGGG + Intergenic
1088297935 11:108321365-108321387 CTTAGCAGGTTGCAGGCCATTGG + Exonic
1089564931 11:119365794-119365816 CTTATTAGATCCCAGGCACTGGG + Intronic
1089625315 11:119747437-119747459 ATTCACAGGTCCCAGGGATTAGG + Intergenic
1090858091 11:130628919-130628941 CTTACTAGGTTCCAGGCACTAGG - Intergenic
1091164761 11:133465387-133465409 GTTCACAGGTCCCAGGGATTAGG + Intronic
1091852952 12:3715119-3715141 CCTACCAGGTTCCAGGCACTGGG + Intronic
1092411791 12:8258606-8258628 CTTCCTAGGTCCCAGGAAATGGG - Intergenic
1095874682 12:47067848-47067870 CTTAAAAGGTATCAGGCAGTAGG - Intergenic
1098917212 12:76269932-76269954 CTTAACAGGGCCCATGCACTGGG + Intergenic
1099957069 12:89361191-89361213 ATTCACAGGTTCCAGGCATTAGG + Intergenic
1101543016 12:105682248-105682270 CTCAACAGGCCCCACACAATTGG - Intergenic
1103920264 12:124395669-124395691 CTTCCCAGTTCTCAGGCAATGGG + Intronic
1104536884 12:129626181-129626203 CTTTACTGGTCCCAGGCTTTGGG + Intronic
1107391494 13:39969469-39969491 CTTAAAAGGTATCAGGCAAATGG + Intergenic
1108216241 13:48187557-48187579 CTTACTATGTTCCAGGCAATGGG + Intergenic
1108432276 13:50366298-50366320 TTAAACAGTGCCCAGGCAATAGG + Intronic
1110847406 13:80206050-80206072 ATTCACAGGTTCCAGGCATTAGG + Intergenic
1112487219 13:99830838-99830860 ATTCACAGGTCCCAGGGATTAGG - Intronic
1115886904 14:37982178-37982200 ATTCACAGGTCCCAGGAATTAGG - Intronic
1117795861 14:59393899-59393921 ATTCACAGGTCCCAGGGATTAGG + Intergenic
1122760233 14:104019453-104019475 TAAAAAAGGTCCCAGGCAATGGG - Intronic
1123707462 15:22960308-22960330 CCTCACAGGTCCCACGCAGTGGG + Intronic
1125170300 15:36759268-36759290 CTTAAAATGCCCCAGGCCATGGG + Intronic
1125769497 15:42155726-42155748 CTTGGCGGGTCCCAGGCATTGGG + Intronic
1128416018 15:67446912-67446934 CTTCACAGCTCTCTGGCAATTGG + Intronic
1129162875 15:73756790-73756812 CCTACCAGGTGCCAGGCACTGGG - Intergenic
1130350032 15:83083322-83083344 CTTACCAGGTCCCACCCACTAGG - Intergenic
1130714821 15:86322993-86323015 CTCCACAGATCCCAGGAAATAGG - Intronic
1133790559 16:9006478-9006500 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1136292929 16:29286724-29286746 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1139001616 16:62517841-62517863 ATTCACAGGTTCCAGGCACTAGG - Intergenic
1139999082 16:71008803-71008825 CTTATCAGGTCTCAGGGCATTGG + Intronic
1141002792 16:80323941-80323963 ATTCACAGGTGCCAGGCATTAGG + Intergenic
1142066418 16:88065507-88065529 CTAAACAGGGCCCAGGGATTGGG + Intronic
1142098815 16:88260729-88260751 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1143621379 17:8082276-8082298 CTTACTAGGTCCCAGGTATTGGG + Intronic
1146502870 17:33379474-33379496 CTTAAAAGGTCCCAGGAGCTAGG - Intronic
1147892235 17:43725530-43725552 CTTACCAAGTCCCAGGCTCTTGG - Intergenic
1148223434 17:45881477-45881499 ATTCACAGGTCCCAGGGACTTGG + Intergenic
1148755724 17:49972072-49972094 CTGCAGAGGTCCCAGGCAATGGG - Intronic
1148787594 17:50152883-50152905 CTTAACTGGTCCCAGCCCAAGGG + Intergenic
1148963273 17:51411370-51411392 CTTCACAGGTACCAGGGATTAGG - Intergenic
1150313048 17:64145361-64145383 CTTAGAATGTGCCAGGCAATTGG + Intergenic
1151285386 17:73107449-73107471 CCTAAAAGGCCCCAGGGAATGGG + Intergenic
1152680036 17:81662753-81662775 CTTTACAGGGCCGAGGCAAGTGG + Intronic
1153169602 18:2300926-2300948 ATTCACAGGTCCTAGGGAATAGG - Intergenic
1156098101 18:33561141-33561163 CTTAACAGCTCCCTGCCAACAGG + Intergenic
1157642834 18:49234661-49234683 GTTCACAGGTTCCAGGCATTAGG - Intronic
1158226864 18:55210483-55210505 CTTGTTAGGTCCCAGACAATGGG + Intergenic
1161066782 19:2242548-2242570 GTTCACAGGTCCCAGGGATTAGG + Intronic
1163049511 19:14671573-14671595 ATTAACAGGTTCCAGGGATTAGG + Intronic
1164193760 19:22935169-22935191 CATAACAGGTCCCAGGACACAGG + Intergenic
1167563182 19:50238806-50238828 ATTCACAGGTCCCAGGGATTAGG + Intronic
926627247 2:15102452-15102474 CTTAACAAGTGCCAGGTACTGGG + Intergenic
927939260 2:27093483-27093505 CCTACCATGTCCCAGGCACTGGG + Intronic
928268581 2:29833582-29833604 CTTACCAGGTGCCAGGCACTGGG + Intronic
928309319 2:30196525-30196547 ATTCACAGGTTCCAGGCACTAGG - Intergenic
929249780 2:39740034-39740056 CTTAATATGTGCCAGGCAGTTGG + Intronic
931249813 2:60520221-60520243 CTCAAAAGTTCCCAGGCAAATGG + Intronic
931265689 2:60658174-60658196 CTTAGCAGGTCCCAGCAGATGGG - Intergenic
932616349 2:73233926-73233948 CTTAATAGGACCAACGCAATAGG + Intronic
941152983 2:161938352-161938374 CAGAACTGATCCCAGGCAATAGG - Intronic
942359352 2:175156009-175156031 ATTAACAGGTTCCAGGGATTAGG - Intronic
944027530 2:195189590-195189612 ATTTACAGGTTCCAGGCATTAGG - Intergenic
944315127 2:198276539-198276561 CTTTGCAGCTCCCAGGCAAAAGG - Intronic
945135339 2:206621563-206621585 CTTCACAGCTCCCATGGAATTGG + Intergenic
945441732 2:209887543-209887565 ATTCACAGGTCCCAGGGATTAGG + Intronic
948267242 2:236643891-236643913 ATTCACAGGTCCCAGGGACTAGG - Intergenic
948492421 2:238321649-238321671 CTTGACAGGTCCCACTCAACAGG - Intronic
1169452997 20:5728254-5728276 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1170340223 20:15317917-15317939 CTTGACTGGTCCCAGACATTTGG - Intronic
1172193597 20:33077090-33077112 CTTACTAAGTGCCAGGCAATGGG + Intergenic
1172232817 20:33348402-33348424 TTTAACAGGAGCCAGGAAATGGG + Intergenic
1172969162 20:38861019-38861041 CTGAAGAGGACCCAGGGAATGGG - Intronic
1174518841 20:51114226-51114248 TTTGACAGGTCCCAGGGATTAGG + Intergenic
1176285135 21:5015486-5015508 CTTGGCAGGTGCCAGGCAACAGG - Intergenic
1176342294 21:5709930-5709952 CTTAACAGTTTCCAGTCAGTTGG - Intergenic
1176474548 21:7142082-7142104 CTTAACAGTTTCCAGTCAGTTGG - Intergenic
1176502533 21:7614526-7614548 CTTAACAGTTTCCAGTCAGTTGG + Intergenic
1176536615 21:8107999-8108021 CTTAACAGTTTCCAGTCAGTTGG - Intergenic
1177929294 21:27260510-27260532 ATTCACAGGTTCCAGGCATTAGG - Intergenic
1178511029 21:33205134-33205156 CTCAACAGGTTCAAGACAATTGG + Intergenic
1179779788 21:43692042-43692064 CTTAACAGGTCCCAGGCAATTGG - Intronic
1179872046 21:44247989-44248011 CTTGGCAGGTGCCAGGCAACAGG + Intronic
1180920547 22:19519492-19519514 CTTAAGGGTTCCCAGGAAATAGG + Intronic
1181101705 22:20545058-20545080 ATTTACAGGTTCCAGGGAATAGG + Intronic
1181812312 22:25411115-25411137 ATTCACAGGTCCCAGGGATTAGG - Intergenic
1182842497 22:33402855-33402877 CTTACTAGGACCCAGGCACTAGG + Intronic
1183074334 22:35417340-35417362 CTTAACAGCCCCCAGGAAAGAGG + Intronic
1183436900 22:37801631-37801653 CTTAATATGTGCCAGGCACTGGG - Intergenic
1203241561 22_KI270733v1_random:24410-24432 CTTAACAGTTTCCAGTCAGTTGG - Intergenic
951267485 3:20586474-20586496 TCTAACAAATCCCAGGCAATGGG + Intergenic
952582262 3:34848356-34848378 CCTAACATGTCCTAGGCACTGGG + Intergenic
952920806 3:38282634-38282656 GTGGACAGGCCCCAGGCAATTGG - Intronic
958736168 3:98011641-98011663 CTTCACAGGTTCCAGGAATTAGG + Intronic
959018853 3:101166694-101166716 ATTCACAGGTGCCAGGCATTAGG - Intergenic
961205857 3:125080963-125080985 ATTCACAGGTTCCAGGGAATAGG - Intergenic
962716362 3:138129208-138129230 ATTAACAGGTTCCAGGAATTAGG - Intronic
963219509 3:142792330-142792352 CTTAAACTATCCCAGGCAATGGG + Intronic
967299494 3:187998627-187998649 CTTACCATGTGCCAGGCACTAGG - Intergenic
969552303 4:7878653-7878675 CTGACCATGTACCAGGCAATAGG + Intronic
970487828 4:16542195-16542217 CCTACCAGGTTCCAGGCACTTGG + Intronic
974067736 4:57095640-57095662 CTAATCATTTCCCAGGCAATGGG - Intronic
977366483 4:96075342-96075364 ATTCACAGGTCCCAGGGATTAGG + Intergenic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
977969605 4:103198329-103198351 CTGAACTGGTCCCAGGAAAATGG + Exonic
979804920 4:124959753-124959775 CTGAACAGGTACAAGGCACTGGG - Intergenic
980402111 4:132304082-132304104 ATTAACAGGTTCCAGGGATTGGG + Intergenic
981473936 4:145169112-145169134 CTTGCCAGGTCCCAGGGGATAGG + Intronic
982013547 4:151129830-151129852 CTTAAGATGTGCCAGGCACTGGG - Intronic
984408219 4:179362099-179362121 CTTATCAGGTCACAGGTGATGGG - Intergenic
986746407 5:10748718-10748740 CTTCACAGAGCCCAGGCAAGTGG + Intronic
987239820 5:15984347-15984369 CTGATCTGGTTCCAGGCAATAGG - Intergenic
989362934 5:40624068-40624090 CATAAAAAGTCTCAGGCAATTGG - Intergenic
990148650 5:52790775-52790797 ATTCACAGGTTCCAGGCATTAGG + Intronic
992177709 5:74166823-74166845 CTTAGCAACTCCCAAGCAATGGG - Intergenic
993115163 5:83711374-83711396 CTTAGCAGTTCCCAGAAAATTGG + Intronic
994668948 5:102743482-102743504 ATTAACAGGTCCAAGCCACTAGG + Intergenic
998175789 5:139901196-139901218 CATCCCAGGTCCCAGGCATTTGG - Intronic
998801198 5:145871256-145871278 CTTATTAGGTCCTAGGCACTTGG - Intronic
1000048152 5:157538617-157538639 ATTACCAGGTCTCAGGAAATCGG - Intronic
1000137503 5:158367070-158367092 TTTAATATGTCCCAGGCACTAGG - Intergenic
1004533724 6:16478899-16478921 CTGCACAGGTCCCAGGCTGTTGG - Intronic
1008965753 6:57311490-57311512 CTTCTCACGTCCCAGACAATGGG + Intergenic
1009836862 6:69012427-69012449 GTTAACCAGTCACAGGCAATTGG + Intronic
1012506214 6:99949348-99949370 CTTGACAGTTCCCAGGAAAGAGG - Intronic
1012528463 6:100205528-100205550 CCTACTAGGTGCCAGGCAATGGG - Intergenic
1012820741 6:104082503-104082525 CTTAACAGGTCCCACACCACTGG - Intergenic
1012878080 6:104753421-104753443 CTTAACAAGTCACAAGGAATGGG - Intronic
1013294612 6:108747454-108747476 CTTAATAGGTCCCCAGCCATGGG - Intergenic
1013656577 6:112253179-112253201 CTTAGCATGTCCCATGCAATGGG + Intronic
1016887418 6:148970981-148971003 ATTCACAGGTCCCAGGGATTAGG + Intronic
1017326492 6:153146562-153146584 ATTCACAGGTTCCAGGGAATAGG - Intergenic
1020159366 7:5756748-5756770 TTTACCAGGTCCCAGGTACTTGG - Intronic
1021426471 7:20505165-20505187 TTTTACACGTCTCAGGCAATAGG + Intergenic
1022769556 7:33454571-33454593 CTTAACAGGTCACTGCCAAGAGG + Intronic
1024588588 7:50861758-50861780 CTTATCAAGTATCAGGCAATGGG - Intergenic
1028356451 7:89916150-89916172 CTTAACATTTTCCAGGCACTAGG + Intergenic
1029961192 7:104690633-104690655 CTTGACAGGCCCCATGCCATGGG - Intronic
1036989761 8:13579057-13579079 CTTAAAATGTCCTAGGCAATAGG - Intergenic
1037364651 8:18108671-18108693 CTTGACAGGTCCCATACAACTGG + Intergenic
1039706386 8:40011677-40011699 CTTAACATGTTCCAGGCCCTGGG + Intronic
1041173536 8:55170212-55170234 GTTCACAGGTTCCAGGCATTAGG - Intronic
1042104911 8:65315937-65315959 CTTCACAGGTCCCAGAGATTGGG + Intergenic
1042350115 8:67768583-67768605 ATTCACAGGTCCCAGGGATTTGG - Intergenic
1043548339 8:81340080-81340102 CCTAACAGGCCCAAGGCAAATGG - Intergenic
1047391087 8:124451882-124451904 CTTAACACTTGGCAGGCAATGGG - Exonic
1047685411 8:127300393-127300415 CCTAACAGGTGCCTGGAAATTGG + Intergenic
1048121631 8:131588181-131588203 CTCAGCAGGTTCCAAGCAATGGG - Intergenic
1048276421 8:133069408-133069430 CTCTACAGCTCCCAGGCATTTGG + Intronic
1052836188 9:33251857-33251879 CTTACCATGTCCCAGGCAAGTGG + Intronic
1053373156 9:37579715-37579737 ATTAACAGGTACCAGCCACTAGG + Intronic
1054746259 9:68856872-68856894 CTTAATAGGTTCCAGGGATTAGG - Intronic
1056491952 9:87117177-87117199 CTTCACAGGTTCTAGGCATTAGG - Intergenic
1056542060 9:87580342-87580364 ATTCACAGGTCCCAGGGATTAGG - Intronic
1057037487 9:91821849-91821871 CTCAGCAGTTCCCAGGCACTGGG + Intronic
1057913216 9:99036055-99036077 CTTATTTTGTCCCAGGCAATGGG - Intronic
1057971524 9:99562885-99562907 CTTACCATGTACCAGGCCATGGG + Intergenic
1057977487 9:99621688-99621710 CCTAATATGTCCCAGGCACTGGG + Intergenic
1058037002 9:100263686-100263708 ATTCACAGGTACCAGGCACTAGG + Intronic
1059463405 9:114449848-114449870 CTTATCATGTGCCAGGCACTGGG + Intronic
1062261768 9:135666474-135666496 CTTCACAGGCTCCAGGCACTAGG + Intergenic
1062528692 9:136990037-136990059 ATTCACAGGTCCCAGGGATTAGG + Intergenic
1203457884 Un_GL000220v1:7485-7507 CTTAACAGTTTCCAGTCAGTTGG - Intergenic
1185822753 X:3220503-3220525 CTTAAAAGGACACAGGCCATTGG + Intergenic
1198650970 X:138863697-138863719 CCTACTAGGTGCCAGGCAATGGG - Intronic
1199875979 X:151928965-151928987 CTTAACAGGAGCCAGGGAAGTGG + Intergenic
1202252890 Y:22891318-22891340 GTTGACAGGGCCCAGGCAAGGGG + Intergenic
1202405879 Y:24525067-24525089 GTTGACAGGGCCCAGGCAAGGGG + Intergenic
1202464901 Y:25145015-25145037 GTTGACAGGGCCCAGGCAAGGGG - Intergenic