ID: 1179780706

View in Genome Browser
Species Human (GRCh38)
Location 21:43699027-43699049
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179780706_1179780710 -8 Left 1179780706 21:43699027-43699049 CCGAACTTCGGGTACGCTGTGGG No data
Right 1179780710 21:43699042-43699064 GCTGTGGGTGGTGTTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179780706 Original CRISPR CCCACAGCGTACCCGAAGTT CGG (reversed) Intergenic
No off target data available for this crispr