ID: 1179781428

View in Genome Browser
Species Human (GRCh38)
Location 21:43703387-43703409
Sequence GGGCTGAGCGGGCAACAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179781428_1179781438 2 Left 1179781428 21:43703387-43703409 CCCACTTGTTGCCCGCTCAGCCC No data
Right 1179781438 21:43703412-43703434 GTCACAGCCCCACCTCGCCGGGG No data
1179781428_1179781437 1 Left 1179781428 21:43703387-43703409 CCCACTTGTTGCCCGCTCAGCCC No data
Right 1179781437 21:43703411-43703433 GGTCACAGCCCCACCTCGCCGGG No data
1179781428_1179781436 0 Left 1179781428 21:43703387-43703409 CCCACTTGTTGCCCGCTCAGCCC No data
Right 1179781436 21:43703410-43703432 CGGTCACAGCCCCACCTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179781428 Original CRISPR GGGCTGAGCGGGCAACAAGT GGG (reversed) Intergenic
No off target data available for this crispr