ID: 1179781436

View in Genome Browser
Species Human (GRCh38)
Location 21:43703410-43703432
Sequence CGGTCACAGCCCCACCTCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179781429_1179781436 -1 Left 1179781429 21:43703388-43703410 CCACTTGTTGCCCGCTCAGCCCC No data
Right 1179781436 21:43703410-43703432 CGGTCACAGCCCCACCTCGCCGG No data
1179781426_1179781436 16 Left 1179781426 21:43703371-43703393 CCTGCTGGACAAAGTCCCCACTT No data
Right 1179781436 21:43703410-43703432 CGGTCACAGCCCCACCTCGCCGG No data
1179781428_1179781436 0 Left 1179781428 21:43703387-43703409 CCCACTTGTTGCCCGCTCAGCCC No data
Right 1179781436 21:43703410-43703432 CGGTCACAGCCCCACCTCGCCGG No data
1179781427_1179781436 1 Left 1179781427 21:43703386-43703408 CCCCACTTGTTGCCCGCTCAGCC No data
Right 1179781436 21:43703410-43703432 CGGTCACAGCCCCACCTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179781436 Original CRISPR CGGTCACAGCCCCACCTCGC CGG Intergenic
No off target data available for this crispr