ID: 1179781437

View in Genome Browser
Species Human (GRCh38)
Location 21:43703411-43703433
Sequence GGTCACAGCCCCACCTCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179781428_1179781437 1 Left 1179781428 21:43703387-43703409 CCCACTTGTTGCCCGCTCAGCCC No data
Right 1179781437 21:43703411-43703433 GGTCACAGCCCCACCTCGCCGGG No data
1179781429_1179781437 0 Left 1179781429 21:43703388-43703410 CCACTTGTTGCCCGCTCAGCCCC No data
Right 1179781437 21:43703411-43703433 GGTCACAGCCCCACCTCGCCGGG No data
1179781426_1179781437 17 Left 1179781426 21:43703371-43703393 CCTGCTGGACAAAGTCCCCACTT No data
Right 1179781437 21:43703411-43703433 GGTCACAGCCCCACCTCGCCGGG No data
1179781427_1179781437 2 Left 1179781427 21:43703386-43703408 CCCCACTTGTTGCCCGCTCAGCC No data
Right 1179781437 21:43703411-43703433 GGTCACAGCCCCACCTCGCCGGG No data
1179781431_1179781437 -10 Left 1179781431 21:43703398-43703420 CCCGCTCAGCCCCGGTCACAGCC No data
Right 1179781437 21:43703411-43703433 GGTCACAGCCCCACCTCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179781437 Original CRISPR GGTCACAGCCCCACCTCGCC GGG Intergenic
No off target data available for this crispr