ID: 1179783689

View in Genome Browser
Species Human (GRCh38)
Location 21:43718425-43718447
Sequence CATCCACAGGTGCCTGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179783689_1179783705 18 Left 1179783689 21:43718425-43718447 CCAGACCCAGGCACCTGTGGATG No data
Right 1179783705 21:43718466-43718488 CATCGGCTGGGGGCCTCTGCAGG No data
1179783689_1179783700 5 Left 1179783689 21:43718425-43718447 CCAGACCCAGGCACCTGTGGATG No data
Right 1179783700 21:43718453-43718475 CCGGGCATGTGGCCATCGGCTGG No data
1179783689_1179783697 -6 Left 1179783689 21:43718425-43718447 CCAGACCCAGGCACCTGTGGATG No data
Right 1179783697 21:43718442-43718464 TGGATGGACGGCCGGGCATGTGG No data
1179783689_1179783703 8 Left 1179783689 21:43718425-43718447 CCAGACCCAGGCACCTGTGGATG No data
Right 1179783703 21:43718456-43718478 GGCATGTGGCCATCGGCTGGGGG No data
1179783689_1179783702 7 Left 1179783689 21:43718425-43718447 CCAGACCCAGGCACCTGTGGATG No data
Right 1179783702 21:43718455-43718477 GGGCATGTGGCCATCGGCTGGGG No data
1179783689_1179783701 6 Left 1179783689 21:43718425-43718447 CCAGACCCAGGCACCTGTGGATG No data
Right 1179783701 21:43718454-43718476 CGGGCATGTGGCCATCGGCTGGG No data
1179783689_1179783698 1 Left 1179783689 21:43718425-43718447 CCAGACCCAGGCACCTGTGGATG No data
Right 1179783698 21:43718449-43718471 ACGGCCGGGCATGTGGCCATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179783689 Original CRISPR CATCCACAGGTGCCTGGGTC TGG (reversed) Intergenic
No off target data available for this crispr